RNA id: TU28640



Basic Information


Item Value
RNA id TU28640
length 208
lncRNA type inter_gene
GC content 0.40
exon number 2
gene id G22844
representative True

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 13483495 ~ 13492334 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATTACTGTGCAAGCAGTAGTCAGAAAAAGCTTTATACTTCTTGCTTGTTCCTTTGAAGCTTTTTTTCACTGCGCTTCAGCTTCCTGGGTTTTTATCCTCAGTTTCCATTAAACCCACTTGACTGTCCTGCAAGTTAGAGAAGCAGTCAGATGTTTTCTGGAAACGCAATAAAGCAACGATGGAAGTTGAAACTGAACACACACCTTNN

Function


GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU28634 lncRNA upstream 129039 13353613 ~ 13354456 (+) True G22839
TU28632 lncRNA upstream 131576 13351626 ~ 13351919 (+) True G22837
TU28611 lncRNA upstream 530399 12952875 ~ 12953096 (+) True G22816
TU28572 lncRNA upstream 1585358 11897543 ~ 11898137 (+) True G22781
TU28566 lncRNA upstream 1603889 11879400 ~ 11879606 (+) True G22775
TU28694 lncRNA downstream 139212 13631546 ~ 13631960 (+) True G22887
TU28695 lncRNA downstream 145090 13637424 ~ 13637624 (+) True G22888
TU28701 lncRNA downstream 184623 13676957 ~ 13677701 (+) True G22893
TU28748 lncRNA downstream 453304 13945638 ~ 13946065 (+) True G22930
TU28750 lncRNA downstream 529757 14022091 ~ 14022317 (+) True G22932
AMCG00007311 mRNA upstream 1879777 11588634 ~ 11603718 (+) True AMCG00007311
AMCG00007310 mRNA upstream 2705788 10758834 ~ 10777707 (+) True AMCG00007310
AMCG00007306 mRNA upstream 2739820 10739045 ~ 10743675 (+) True AMCG00007306
AMCG00007305 mRNA upstream 2816200 10660181 ~ 10667295 (+) True AMCG00007305
AMCG00007308 mRNA upstream 2828506 10628350 ~ 10654989 (+) True AMCG00007308
AMCG00007317 mRNA downstream 49422 13541756 ~ 13551121 (+) True AMCG00007317
AMCG00007321 mRNA downstream 130810 13623144 ~ 13624807 (+) True AMCG00007321
AMCG00007322 mRNA downstream 154293 13646627 ~ 13647013 (+) True AMCG00007322
AMCG00007328 mRNA downstream 482971 13975305 ~ 13981853 (+) True AMCG00007328
AMCG00007327 mRNA downstream 557059 14049393 ~ 14064082 (+) True AMCG00007327
TU28420 other upstream 2870391 10611196 ~ 10613104 (+) True AMCG00007307
TU28037 other upstream 3983767 9436524 ~ 9499728 (+) True G22372
TU27900 other upstream 4772184 8704657 ~ 8711311 (+) True AMCG00007253
TU27825 other upstream 5087253 8367436 ~ 8396242 (+) True AMCG00007243
TU27445 other upstream 6104549 7374323 ~ 7378946 (+) True G21891
TU28829 other downstream 986339 14478673 ~ 14489692 (+) True AMCG00007337
TU28988 other downstream 1794163 15286497 ~ 15287960 (+) False AMCG00007352
TU29675 other downstream 4706434 18198768 ~ 18201960 (+) True AMCG00007417
TU29676 other downstream 4714744 18207078 ~ 18208308 (+) True G23698
TU29705 other downstream 4797774 18290108 ~ 18292338 (+) True G23724

Expression Profile


TU28640 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 300.
End of interactive chart.

TU28640 Expression in each Bioproject

Bar chart with 4 bars.
TU28640 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.