RNA id: TU33771



Basic Information


Item Value
RNA id TU33771
length 373
RNA type TUCP
GC content 0.52
exon number 1
gene id G26961
representative True

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 34869435 ~ 34869807 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ctccatcatccgtaaatggaagaagtttggaaccaccaggactcttcctagagctggccaccggccaaactgagcgatcggaggagaagggccttagtcagggaggtgaccaagaacccgatggtcactctgacagagctccagcgtgtctctgtggagagaggagaaccttccagaagaacaaccatctctgcagcactccaccaatcaggcctgtatggtagagtggccagacggaagccactcctcagtaaaaggcacatgacagcccacctggagtttgccaaaaggcacctgaaggactctcagaccatgagaaacaaaattctctggtctgatgaaacaaagattgaactcatgtctggaggaaacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU33762 lncRNA downstream 52515 34816694 ~ 34816920 (-) True G26952
TU33753 lncRNA downstream 72582 34796169 ~ 34796853 (-) True G26943
TU33700 lncRNA downstream 615870 34249199 ~ 34253565 (-) True G26893
TU33689 lncRNA downstream 646204 34189496 ~ 34223231 (-) True G26883
TU33638 lncRNA downstream 875477 33992135 ~ 33993958 (-) True G26848
TU33805 lncRNA upstream 661123 35530930 ~ 35531438 (-) True G26994
TU33806 lncRNA upstream 667497 35537304 ~ 35537636 (-) True G26995
TU33808 lncRNA upstream 681064 35550871 ~ 35552507 (-) True G26997
TU33838 lncRNA upstream 725623 35595430 ~ 35603175 (-) True G27023
TU33928 lncRNA upstream 1133386 36003193 ~ 36005750 (-) False AMCG00007883
AMCG00007869 mRNA downstream 64557 34796895 ~ 34804878 (-) True AMCG00007869
AMCG00007861 mRNA downstream 826539 34011110 ~ 34042896 (-) True AMCG00007861
AMCG00007862 mRNA downstream 869697 33995712 ~ 33999738 (-) True AMCG00007862
AMCG00007859 mRNA downstream 931355 33922475 ~ 33938080 (-) True AMCG00007859
AMCG00007856 mRNA downstream 1055502 33800570 ~ 33813933 (-) True AMCG00007856
AMCG00007874 mRNA upstream 686443 35556250 ~ 35594137 (-) True AMCG00007874
AMCG00007875 mRNA upstream 756003 35625810 ~ 35637920 (-) True AMCG00007875
AMCG00007876 mRNA upstream 780037 35649844 ~ 35665471 (-) True AMCG00007876
AMCG00007877 mRNA upstream 848217 35718024 ~ 35735817 (-) True AMCG00007877
AMCG00007880 mRNA upstream 970346 35840153 ~ 35852765 (-) True AMCG00007880
TU31949 other downstream 9237843 25630795 ~ 25631592 (-) True AMCG00007684
TU31883 other downstream 9604484 25264332 ~ 25264951 (-) True G25422
TU31562 other downstream 10601514 24265824 ~ 24267921 (-) False AMCG00007637
TU31390 other downstream 10896770 23971671 ~ 23972665 (-) True G25026
TU30382 other downstream 14396731 20471111 ~ 20472704 (-) True AMCG00007500
TU34246 other upstream 2370282 37240089 ~ 37242983 (-) False AMCG00007929
TU34303 other upstream 2625104 37494911 ~ 37499392 (-) True G27416
TU34324 other upstream 2697810 37567617 ~ 37569284 (-) True G27437
TU34326 other upstream 2701150 37570957 ~ 37571488 (-) True G27439
TU34329 other upstream 2703227 37573034 ~ 37588525 (-) True G27442

Expression Profile


TU33771 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

TU33771 Expression in each Bioproject

Bar chart with 7 bars.
TU33771 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.