RNA id: TU34987



Basic Information


Item Value
RNA id TU34987
length 261
lncRNA type inter_gene
GC content 0.61
exon number 2
gene id G27949
representative True

Chromosome Information


Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 39842331 ~ 39847044 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


TGAATCCAAACACCCACCATGTGTGCGGCGTGTCTCAGGTGAGGATACGGGATGAAGCTGTACTCCTGCAACCCGGGATAAGACACGGGCAGCCCGGCAACAGCAGAGAGGTGAGGCGCCGGGGGGACCCCTGTCGGGCACCCCACAACCAAAGTCTGATATCCAGGCGGCATGCTGAGGTTTTTCCCAAGGAAGAAATCTGCAAATCCAGTGTGCGGCGCAGGCATGCTTCTCGTCGGGCTGTCGGAGTCGGAGTGCCGC

Function


GO:

id name namespace
GO:0031231 intrinsic component of peroxisomal membrane cellular_component
GO:0005777 peroxisome cellular_component
GO:0005778 peroxisomal membrane cellular_component
GO:0005779 integral component of peroxisomal membrane cellular_component
GO:0044438 obsolete microbody part cellular_component
GO:0044439 obsolete peroxisomal part cellular_component
GO:0031903 microbody membrane cellular_component
GO:0042579 microbody cellular_component

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU34962 lncRNA downstream 50847 39790546 ~ 39791484 (-) True G27927
TU34927 lncRNA downstream 77914 39763930 ~ 39764417 (-) True G27904
TU34831 lncRNA downstream 386473 39455040 ~ 39455858 (-) True G27833
TU34645 lncRNA downstream 914760 38924581 ~ 38927571 (-) True AMCG00007983
TU34638 lncRNA downstream 919643 38920970 ~ 38922688 (-) True G27686
TU35107 lncRNA upstream 421228 40268272 ~ 40273788 (-) True AMCG00008042
TU35109 lncRNA upstream 430119 40277163 ~ 40277647 (-) True G28036
TU35108 lncRNA upstream 431683 40278727 ~ 40288574 (-) False AMCG00008042
TU35176 lncRNA upstream 780733 40627777 ~ 40632764 (-) True G28095
TU35192 lncRNA upstream 812837 40659881 ~ 40663760 (-) True G28110
AMCG00008019 mRNA downstream 214229 39592332 ~ 39628102 (-) True AMCG00008019
AMCG00008016 mRNA downstream 275777 39557576 ~ 39566554 (-) True AMCG00008016
AMCG00008014 mRNA downstream 300385 39528389 ~ 39541946 (-) True AMCG00008014
AMCG00008017 mRNA downstream 317005 39518444 ~ 39525326 (-) True AMCG00008017
AMCG00008018 mRNA downstream 325064 39513466 ~ 39517267 (-) True AMCG00008018
AMCG00008025 mRNA upstream 82487 39929531 ~ 39945352 (-) True AMCG00008025
AMCG00008026 mRNA upstream 134568 39981612 ~ 39984433 (-) True AMCG00008026
AMCG00008029 mRNA upstream 139884 39986928 ~ 40008602 (-) True AMCG00008029
AMCG00008028 mRNA upstream 203985 40051029 ~ 40061973 (-) True AMCG00008028
AMCG00008032 mRNA upstream 230464 40077508 ~ 40091201 (-) True AMCG00008032
TU34865 other downstream 337739 39500321 ~ 39504592 (-) True G27861
TU34691 other downstream 750576 39088922 ~ 39091755 (-) False AMCG00007993
TU34686 other downstream 786652 39054153 ~ 39055679 (-) True G27720
TU34684 other downstream 792734 39047289 ~ 39049597 (-) False AMCG00007990
TU34421 other downstream 1677789 38161286 ~ 38164542 (-) True G27522
TU35307 other upstream 1169115 41016159 ~ 41017248 (-) True G28202
TU35381 other upstream 1352445 41199489 ~ 41201825 (-) True AMCG00008069
TU35536 other upstream 1999889 41846933 ~ 41849890 (-) True AMCG00008085
TU35782 other upstream 2913960 42761004 ~ 42764654 (-) True G28581
TU36269 other upstream 4570830 44417874 ~ 44418196 (-) True G28970

Expression Profile