RNA id: TU67939



Basic Information


Item Value
RNA id TU67939
length 491
lncRNA type inter_gene
GC content 0.44
exon number 2
gene id G54356
representative True

Chromosome Information


Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 24277905 ~ 24278561 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


caaagaaatgatcagtctataattttaatggtaggtgtattttaacagtgagagacagaataacaacaaaaaaatccagaaaaacacatttcaaaaaagttatacattgatttgcatgttaatgagggaaataagtatttgaccccttcgacttagtacttggtggcaaaacccttgttggcaatcacagaggtcagacgctaggccactccaggaccttaatgtgcttcttcttgagccactcctttgttgccttggctgtgtgttttgggtcattgtcatgctggaatatccatccacgacccattttcaatgccctggctgagggaaggaggttctcacccaagatttgacggtacatggccccgtccatcgtccctttgatgcggtgcagttgtcctgtctccttaatgtttccacctccatgtttgacggtggggatggtgttctccaaacacgagttgagttgatgccaaagagcttgattttgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU67901 lncRNA upstream 111844 24165790 ~ 24166061 (+) True G54328
TU67815 lncRNA upstream 383618 23890127 ~ 23894287 (+) True G54264
TU67787 lncRNA upstream 613253 23664157 ~ 23664652 (+) True G54238
TU67786 lncRNA upstream 613811 23663393 ~ 23664094 (+) True G54237
TU67740 lncRNA upstream 828428 23447154 ~ 23449477 (+) True G54194
TU68038 lncRNA downstream 504949 24783510 ~ 24787085 (+) True G54430
TU68188 lncRNA downstream 893440 25172001 ~ 25172864 (+) True G54547
TU68209 lncRNA downstream 1029699 25308260 ~ 25308495 (+) True G54563
TU68212 lncRNA downstream 1068717 25347278 ~ 25348983 (+) True G54566
TU68232 lncRNA downstream 1126109 25404670 ~ 25413822 (+) True G54580
AMCG00009072 mRNA upstream 55938 24218804 ~ 24221967 (+) True AMCG00009072
AMCG00009070 mRNA upstream 61058 24212416 ~ 24216847 (+) True AMCG00009070
AMCG00009069 mRNA upstream 71384 24200357 ~ 24206521 (+) True AMCG00009069
AMCG00009066 mRNA upstream 206175 24063842 ~ 24071730 (+) True AMCG00009066
AMCG00009064 mRNA upstream 227961 24029392 ~ 24049944 (+) True AMCG00009064
AMCG00009079 mRNA downstream 183377 24461938 ~ 24498489 (+) True AMCG00009079
AMCG00009076 mRNA downstream 287878 24566439 ~ 24631632 (+) True AMCG00009076
AMCG00009078 mRNA downstream 355829 24634390 ~ 24647480 (+) True AMCG00009078
AMCG00009077 mRNA downstream 371153 24649714 ~ 24654285 (+) True AMCG00009077
AMCG00009080 mRNA downstream 385742 24664303 ~ 24666228 (+) True AMCG00009080
TU67814 other upstream 301999 23883317 ~ 23975906 (+) True G54263
TU67408 other upstream 2984004 21292241 ~ 21293901 (+) True G53917
TU67406 other upstream 3002551 21274611 ~ 21275354 (+) True G53915
TU67402 other upstream 3109330 21168231 ~ 21168575 (+) True G53911
TU66948 other upstream 5723945 18550772 ~ 18553960 (+) True G53520
TU68049 other downstream 534057 24812618 ~ 24816534 (+) True AMCG00009085
TU68059 other downstream 636468 24915029 ~ 24917863 (+) False AMCG00009088
TU68288 other downstream 1306331 25584892 ~ 25587610 (+) False AMCG00009108
TU68775 other downstream 3335022 27613583 ~ 27617378 (+) False AMCG00009164
TU69158 other downstream 4487893 28766454 ~ 28777621 (+) False AMCG00009204

Expression Profile


TU67939 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU67939 Expression in each Bioproject

Bar chart with 6 bars.
TU67939 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.