RNA id: TU70601



Basic Information


Item Value
RNA id TU70601
length 210
lncRNA type sense_over
GC content 0.40
exon number 2
gene id G56474
representative True

Chromosome Information


Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 34582947 ~ 34662345 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


tctgtatccaatgtgctccagtctacctcttctaagtgccgcctcataccttcaaggtttgcttttctaaaattgtagaccattgttttagacttggaccttgttttttgaaagaatgcctcaaagctaaccatattgtgatcacaatttgccattggttctctaactactgtccccctgactctatcttggtcatttgaaaagatcaag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU70574 lncRNA upstream 214273 34363499 ~ 34368674 (+) False AMCG00009345
TU70575 lncRNA upstream 216228 34363499 ~ 34366719 (+) False AMCG00009345
TU70484 lncRNA upstream 504108 34045490 ~ 34078839 (+) True G56379
TU70463 lncRNA upstream 540688 34038134 ~ 34042259 (+) True G56376
TU70350 lncRNA upstream 1125775 33456891 ~ 33457172 (+) True G56282
TU70625 lncRNA downstream 300409 34962754 ~ 34963224 (+) True G56495
TU70631 lncRNA downstream 357889 35020234 ~ 35067229 (+) True G56501
TU70674 lncRNA downstream 876542 35538887 ~ 35539780 (+) False G56541
TU70675 lncRNA downstream 876542 35538887 ~ 35539780 (+) False G56541
TU70676 lncRNA downstream 876542 35538887 ~ 35539780 (+) False G56541
AMCG00009355 mRNA upstream 79688 34502648 ~ 34503259 (+) True AMCG00009355
AMCG00009349 mRNA upstream 152531 34399115 ~ 34430416 (+) True AMCG00009349
AMCG00009345 mRNA upstream 213690 34363419 ~ 34369257 (+) True AMCG00009345
AMCG00009346 mRNA upstream 220511 34355739 ~ 34362436 (+) True AMCG00009346
AMCG00009343 mRNA upstream 328858 34220572 ~ 34254089 (+) True AMCG00009343
AMCG00009360 mRNA downstream 27413 34689758 ~ 34690484 (+) True AMCG00009360
AMCG00009361 mRNA downstream 57666 34720011 ~ 34720679 (+) True AMCG00009361
AMCG00009359 mRNA downstream 78888 34741233 ~ 34741959 (+) True AMCG00009359
AMCG00009367 mRNA downstream 122333 34784678 ~ 34784977 (+) True AMCG00009367
AMCG00009368 mRNA downstream 182123 34844468 ~ 34865640 (+) True AMCG00009368
TU70453 other upstream 551502 34000796 ~ 34031445 (+) True G56368
TU70456 other upstream 564132 34015670 ~ 34018815 (+) True G56369
TU70069 other upstream 2417582 32161760 ~ 32165365 (+) True G56060
TU69474 other upstream 4587509 29995126 ~ 29995438 (+) True G55591
TU69455 other upstream 4671383 29907911 ~ 29911564 (+) True G55573
TU70668 other downstream 726569 35388914 ~ 35389327 (+) True G56536
TU70945 other downstream 2697756 37360101 ~ 37367671 (+) True AMCG00009405
TU71113 other downstream 2947998 37610343 ~ 37616283 (+) False AMCG00009428
TU71381 other downstream 3779910 38442255 ~ 38457592 (+) True G57105
TU71670 other downstream 4772555 39434900 ~ 39436995 (+) True AMCG00009480

Expression Profile


TU70601 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

TU70601 Expression in each Bioproject

Bar chart with 7 bars.
TU70601 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.