RNA id: TU72449


Basic Information

Item Value
RNA id TU72449
length 207
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G57948
representative True

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 42427842 ~ 42428048 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

AAATGCACCAGGTTGAACCTACTGTCCCATAGGTTTTTTAGTGCCATCGAGGAGTTTTCTGATAGGTTGTTGCCCCCCAACAGGAGACCAGTCAGAGTTTTGCTGCTCGCTACCACCCTCTGCCACTGAGCTTGCACGTGACCAGCCTGCAGGGAAACCAAGCACACAATGCTGAAATCTGCAGACTGGAGAGAAGGCTAATCAAGA

Function

GO:

id name namespace
GO:0051674 localization of cell biological_process
GO:0050900 leukocyte migration biological_process
GO:0016477 cell migration biological_process
GO:0002376 immune system process biological_process
GO:0048870 cell motility biological_process
GO:0040011 locomotion biological_process
GO:0030595 leukocyte chemotaxis biological_process
GO:0060326 cell chemotaxis biological_process

KEGG:

id description
ko04650 Natural killer cell mediated cytotoxicity
ko04660 T cell receptor signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation
ko05340 Primary immunodeficiency

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU72448 lncRNA upstream 7019 42418590 ~ 42420823 (+) True G57947
TU72447 lncRNA upstream 9337 42418141 ~ 42418505 (+) True G57946
TU72446 lncRNA upstream 9733 42415590 ~ 42418109 (+) True G57945
TU72439 lncRNA upstream 25390 42402235 ~ 42402452 (+) True G57940
TU72317 lncRNA upstream 339697 42085279 ~ 42088145 (+) True G57843
TU72466 lncRNA downstream 4829 42432877 ~ 42435124 (+) True G57964
TU72470 lncRNA downstream 4872 42432920 ~ 42435152 (+) False G57964
TU72493 lncRNA downstream 40260 42468308 ~ 42468602 (+) True G57981
TU72499 lncRNA downstream 49667 42477715 ~ 42478112 (+) True G57987
TU72524 lncRNA downstream 201491 42629539 ~ 42636453 (+) True G58008
AMCG00009600 mRNA upstream 12297 42414205 ~ 42415545 (+) True AMCG00009600
AMCG00009594 mRNA upstream 28511 42385499 ~ 42399331 (+) True AMCG00009594
AMCG00009591 mRNA upstream 129752 42290154 ~ 42298090 (+) True AMCG00009591
AMCG00009593 mRNA upstream 147413 42275999 ~ 42280429 (+) True AMCG00009593
AMCG00009586 mRNA upstream 156645 42266822 ~ 42271197 (+) True AMCG00009586
AMCG00009595 mRNA downstream 18909 42446957 ~ 42463730 (+) True AMCG00009595
AMCG00009604 mRNA downstream 60389 42488437 ~ 42489969 (+) True AMCG00009604
AMCG00009606 mRNA downstream 103669 42531717 ~ 42546719 (+) True AMCG00009606
AMCG00009605 mRNA downstream 138572 42566620 ~ 42570939 (+) True AMCG00009605
AMCG00009608 mRNA downstream 168045 42596093 ~ 42599734 (+) True AMCG00009608
TU72303 other upstream 349601 42036018 ~ 42078241 (+) True G57830
TU72035 other upstream 1433183 40990802 ~ 40994659 (+) True G57604
TU71881 other upstream 2322894 40102383 ~ 40104948 (+) False AMCG00009516
TU71802 other upstream 2478642 39948006 ~ 39949200 (+) True G57430
TU71670 other upstream 2990847 39434900 ~ 39436995 (+) True AMCG00009480
TU72919 other downstream 1504904 43932952 ~ 43935762 (+) True G58324
TU73161 other downstream 1958449 44386497 ~ 44387964 (+) False G58522
TU73232 other downstream 2139317 44567365 ~ 44570531 (+) True AMCG00009694
TU73244 other downstream 2156514 44584562 ~ 44599328 (+) False AMCG00009700
TU73251 other downstream 2204702 44632750 ~ 44651967 (+) True G58600

Expression Profile