RNA id: TU133192


Basic Information

Item Value
RNA id TU133192
length 238
lncRNA type inter_gene
GC content 0.50
exon number 3
gene id G106455
representative True

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 21932604 ~ 22062654 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

CCGGATGCGGTTGCGCAGTCAGAAGGTCAGCTTGCAGCTGCTTCAAATGTGTAAGGTTAAAGGTGTCTCCAAAAACATGTAGCAGAAATCTCCATTCCCCAGAGACCAAATATCATTCTGAAGATGTGACGATTGAGGAGGACAGCCTGCACACAGAAACAACAGAAGGTTGGAAACGTGGAGACTGGAGTCAGCCTGTTTGCAGATGCTGATATTGAGACGCTGGGGCTCGACCAGG

Function

GO:

id name namespace
GO:0031231 intrinsic component of peroxisomal membrane cellular_component
GO:0005777 peroxisome cellular_component
GO:0005778 peroxisomal membrane cellular_component
GO:0005779 integral component of peroxisomal membrane cellular_component
GO:0044438 obsolete microbody part cellular_component
GO:0044439 obsolete peroxisomal part cellular_component
GO:0031903 microbody membrane cellular_component
GO:0042579 microbody cellular_component

KEGG:

id description
ko00061 Fatty acid biosynthesis

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU133180 lncRNA upstream 4027 21926899 ~ 21928577 (+) True G106443
TU133122 lncRNA upstream 691111 21215621 ~ 21241493 (+) True G106391
TU133088 lncRNA upstream 797991 21134255 ~ 21134613 (+) True G106362
TU133087 lncRNA upstream 800174 21131698 ~ 21132430 (+) True G106361
TU133072 lncRNA upstream 899416 21028793 ~ 21033188 (+) True G106347
TU133195 lncRNA downstream 27403 22090057 ~ 22090265 (+) True G106457
TU133202 lncRNA downstream 249060 22311714 ~ 22311963 (+) True G106464
TU133216 lncRNA downstream 480625 22543279 ~ 22544072 (+) True G106478
TU133215 lncRNA downstream 481530 22544184 ~ 22544435 (+) True G106477
TU133217 lncRNA downstream 484510 22547164 ~ 22547407 (+) True G106479
AMCG00011389 mRNA upstream 8346 21923959 ~ 21924258 (+) True AMCG00011389
AMCG00011390 mRNA upstream 56271 21868788 ~ 21876333 (+) True AMCG00011390
AMCG00011388 mRNA upstream 134641 21792528 ~ 21797963 (+) True AMCG00011388
AMCG00011387 mRNA upstream 546741 21319424 ~ 21385863 (+) True AMCG00011387
AMCG00011381 mRNA upstream 695849 21227210 ~ 21236755 (+) True AMCG00011381
AMCG00011392 mRNA downstream 441318 22503972 ~ 22506745 (+) True AMCG00011392
AMCG00011394 mRNA downstream 537264 22599918 ~ 22603575 (+) True AMCG00011394
AMCG00011395 mRNA downstream 541362 22604016 ~ 22630597 (+) True AMCG00011395
AMCG00011397 mRNA downstream 583378 22646032 ~ 22650834 (+) True AMCG00011397
AMCG00011396 mRNA downstream 607087 22669741 ~ 22691805 (+) True AMCG00011396
TU132939 other upstream 1565381 20361208 ~ 20367223 (+) True G106242
TU132823 other upstream 1593517 20296011 ~ 20339087 (+) False AMCG00011365
TU132810 other upstream 1769638 20095229 ~ 20162966 (+) False G106139
TU133378 other downstream 1278654 23341308 ~ 23341765 (+) True G106613
TU133383 other downstream 1293408 23356062 ~ 23356559 (+) True G106618
TU133489 other downstream 1686020 23748674 ~ 23753002 (+) True G106711
TU133992 other downstream 4293513 26356167 ~ 26360775 (+) True AMCG00011476
TU134100 other downstream 4707784 26770438 ~ 26771214 (+) True G107202

Expression Profile