RNA id: AMCG00012254


Basic Information

Item Value
RNA id AMCG00012254
length 474
RNA type mRNA
GC content 0.55
exon number 4
gene id AMCG00012254
representative True

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 13979470 ~ 13982769 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGCTATCGTTGGAACGCAACGCAGAGAGTGCCATTGAGGCTCTGAAGGAGTATGAGCCAGAGATTGCAAAGGTGTACAGGACAGACAGGAAGAGTGTCCAGAGGATTAAGGCCAGAGAGCTCGTGCCTGGAGACATTGTGGATGTGGCTGCGGGCAAAGCCATTGGCGTGGTTGTGTCCACCGGCGTCTCCACAGAGATTGGCAAAATCCGCGACCAGATGGCGGCCACTGAGCAGGAGAAGACTCCCCTGCAGCAGAAGCTGGACGAGTTTGGCGAGCAGCTGTCCAAGGTCATCTCCCTGATCTGTGTTGCTGTCTGGCTCATCAACATTGGCCACTTCAACGACCCCGTGCACGGCGGCTCCTGGATCCGTGGTGCCATGTTCATCGTGGATAAAGTAGAGGGCGACAACTGCAGCCTGAATGAATTCAACATTTCTGGCTCCAAATATACCCCCGAGGGAGAAGTGTGA

Function

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0006942 regulation of striated muscle contraction biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0009612 response to mechanical stimulus biological_process
GO:0045932 negative regulation of muscle contraction biological_process
GO:0006816 calcium ion transport biological_process
GO:0006874 cellular calcium ion homeostasis biological_process
GO:0005783 endoplasmic reticulum cellular_component
GO:0044425 obsolete membrane part cellular_component
GO:0030017 sarcomere cellular_component
GO:0046872 metal ion binding molecular_function
GO:0019829 ATPase-coupled cation transmembrane transporter activity molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU170057 lncRNA upstream 23165 13927988 ~ 13956305 (+) True G135366
TU170034 lncRNA upstream 30643 13946316 ~ 13948827 (+) True G135356
TU170033 lncRNA upstream 73123 13905475 ~ 13906347 (+) True G135355
TU170037 lncRNA upstream 74179 13904716 ~ 13905291 (+) True G135359
TU170036 lncRNA upstream 74934 13902307 ~ 13904536 (+) True G135358
TU170089 lncRNA downstream 191178 14173947 ~ 14176807 (+) False AMCG00012262
TU170228 lncRNA downstream 244221 14226990 ~ 14232263 (+) True G135506
TU170265 lncRNA downstream 385280 14368049 ~ 14368337 (+) True G135540
TU170270 lncRNA downstream 390271 14373040 ~ 14373945 (+) True G135542
TU170275 lncRNA downstream 394903 14377672 ~ 14378695 (+) True G135544
AMCG00012255 mRNA upstream 2246 13968531 ~ 13977224 (+) True AMCG00012255
AMCG00012246 mRNA upstream 94340 13882244 ~ 13885130 (+) True AMCG00012246
AMCG00012244 mRNA upstream 102328 13860050 ~ 13877142 (+) True AMCG00012244
AMCG00012247 mRNA upstream 124415 13853948 ~ 13855055 (+) False AMCG00012247
AMCG00012248 mRNA upstream 137477 13838455 ~ 13841993 (+) True AMCG00012248
AMCG00012252 mRNA downstream 1695 13984464 ~ 13989166 (+) True AMCG00012252
AMCG00012251 mRNA downstream 66183 14048952 ~ 14057554 (+) True AMCG00012251
AMCG00012253 mRNA downstream 79677 14062446 ~ 14069189 (+) False AMCG00012253
AMCG00012260 mRNA downstream 117331 14100100 ~ 14117969 (+) True AMCG00012260
AMCG00012262 mRNA downstream 191144 14173913 ~ 14183167 (+) True AMCG00012262
TU170021 other upstream 124551 13850378 ~ 13854919 (+) True AMCG00012247
TU169982 other upstream 165714 13807213 ~ 13813756 (+) False AMCG00012245
TU169904 other upstream 393554 13584270 ~ 13585916 (+) True G135264
TU169873 other upstream 458976 13519421 ~ 13520494 (+) True G135240
TU169844 other upstream 470671 13506190 ~ 13508799 (+) True AMCG00012228
TU170041 other downstream 79468 14062237 ~ 14095797 (+) True AMCG00012253
TU170232 other downstream 263994 14246763 ~ 14295415 (+) True AMCG00012268
TU170267 other downstream 392864 14375633 ~ 14377651 (+) True G135541
TU170274 other downstream 394903 14377672 ~ 14378695 (+) False G135544
TU170281 other downstream 405306 14388075 ~ 14389685 (+) False AMCG00012267

Expression Profile