RNA id: AMCG00014823


Basic Information

Item Value
RNA id AMCG00014823
length 507
RNA type mRNA
GC content 0.50
exon number 2
gene id AMCG00014823
representative True

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 32791881 ~ 32793425 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGACTTATCCGAACTGTTCGGCTAATGCCACTGTTTGCAGTGGCACGTCTTGCCTGGAGCCTTCAAGCAACGCTAACGAGATTCTGAGTCTGGTTCTAAGCACGGTGTTGACAGTAATGCTGGCAATAGTGATGTTCTCCATGGGCTGTACAGTAGAGGCAAGAAAACTGTGGGGACACATCAAGAGGCCTTGGGGAATTTTCATCGGCTTTCTCTGTCAGTTCGGTATCATGCCAATGGTGGCGTTTCTGTTGTCTCTCGCCTTCCAAGTACAGCCCATTCAGGCAGTAGCGATCTTGGTCATGGGCTGCTGTCCTGGGGGTTCTGGGTCCAATATTTTAGCCTACTGGTTAGATGGGGACATGGACCTCAGCATAAGCATGACCGCCTGTTCCTCGATTCTGGCAATGGGAATGATGCCATTGTGCCTTCTCATCTACACCACAATGTGGACCTCAACTAGCGCCGTCCAGATACCTTACGACAGCATTGGTAAGACGTGTTAA

Function

GO:

id name namespace
GO:0015721 bile acid and bile salt transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process
GO:0006869 lipid transport biological_process
GO:0016021 integral component of membrane cellular_component
GO:0008508 bile acid molecular_function

KEGG:

id description
K03453 TC.BASS; bile acid:Na+ symporter, BASS family

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU91443 lncRNA downstream 1483 32789023 ~ 32790398 (-) True G73187
TU91439 lncRNA downstream 80178 32711247 ~ 32711703 (-) True G73184
TU91438 lncRNA downstream 80836 32710797 ~ 32711045 (-) True G73183
TU91437 lncRNA downstream 81766 32709844 ~ 32710115 (-) True G73182
TU91436 lncRNA downstream 83598 32708013 ~ 32708283 (-) True G73181
TU91487 lncRNA upstream 276824 33070249 ~ 33071524 (-) True AMCG00014825
TU91497 lncRNA upstream 453912 33247337 ~ 33247621 (-) True G73232
TU91509 lncRNA upstream 526000 33319425 ~ 33319625 (-) True G73242
TU91512 lncRNA upstream 572283 33365708 ~ 33366083 (-) True G73245
TU91532 lncRNA upstream 852508 33645933 ~ 33702805 (-) True G73259
AMCG00014818 mRNA downstream 138461 32650176 ~ 32653420 (-) True AMCG00014818
AMCG00014819 mRNA downstream 142886 32647534 ~ 32648995 (-) True AMCG00014819
AMCG00014820 mRNA downstream 149949 32628832 ~ 32641932 (-) True AMCG00014820
AMCG00014816 mRNA downstream 236348 32502317 ~ 32555533 (-) True AMCG00014816
AMCG00014814 mRNA downstream 469122 32321974 ~ 32322759 (-) True AMCG00014814
AMCG00014824 mRNA upstream 1580 32795005 ~ 32806293 (-) False AMCG00014824
AMCG00014825 mRNA upstream 277381 33070806 ~ 33119328 (-) False AMCG00014825
AMCG00014826 mRNA upstream 334253 33127678 ~ 33434382 (-) True AMCG00014826
AMCG00014828 mRNA upstream 1771061 34564486 ~ 34565202 (-) True AMCG00014828
AMCG00014829 mRNA upstream 2117168 34910593 ~ 34931646 (-) True AMCG00014829
TU91374 other downstream 172732 32597462 ~ 32619149 (-) False G73127
TU91373 other downstream 177075 32597462 ~ 32614806 (-) True G73127
TU91283 other downstream 528454 32263167 ~ 32263427 (-) True G73047
TU90581 other downstream 3393576 29389290 ~ 29398305 (-) True G72477
TU90285 other downstream 4459399 28329739 ~ 28332482 (-) True G72236
TU91480 other upstream 8433 32801858 ~ 32806295 (-) True AMCG00014824
TU91607 other upstream 1976158 34769583 ~ 34769979 (-) True G73328
TU91914 other upstream 2787201 35580626 ~ 35608677 (-) True AMCG00014839
TU91940 other upstream 3307933 36101358 ~ 36182351 (-) True G73604
TU91951 other upstream 3460349 36253774 ~ 36254187 (-) True G73612

Expression Profile