RNA id: TU125964


Basic Information

Item Value
RNA id TU125964
length 284
lncRNA type inter_gene
GC content 0.44
exon number 3
gene id G100863
representative True

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 23839798 ~ 23961637 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

tcattgtcatgttcaaagtccaatcatttcaaattggtttcttgaacatgacaatgagttcactgtactaaactggcccccacagtcaccagatctcaacccaatagagcatctttgggatgtggtggaacgggagcttcgtgccctggatgtgcatcccacaaatctccatcaactgcaagatgctatcctatcaatatgggccaacatttctaaagaatgctttcagcaccttgttgaatcaatgccacgtagaattaaggcagttctgaaggcgaaaggag

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0052547 regulation of peptidase activity biological_process
GO:0051336 regulation of hydrolase activity biological_process
GO:0021510 spinal cord development biological_process
GO:0021514 ventral spinal cord interneuron differentiation biological_process
GO:0021515 cell differentiation in spinal cord biological_process
GO:0021517 ventral spinal cord development biological_process
GO:0005540 hyaluronic acid binding molecular_function
GO:0031406 carboxylic acid binding molecular_function
GO:0043177 organic acid binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU125958 lncRNA upstream 77275 23762291 ~ 23762523 (+) True G100858
TU125896 lncRNA upstream 555721 23283691 ~ 23284077 (+) True G100801
TU125866 lncRNA upstream 621482 23216051 ~ 23218316 (+) True G100776
TU125778 lncRNA upstream 916402 22835254 ~ 22923396 (+) True G100709
TU125775 lncRNA upstream 1019095 22820501 ~ 22820703 (+) True G100707
TU126009 lncRNA downstream 109189 24070826 ~ 24156851 (+) True G100903
TU126087 lncRNA downstream 523192 24484829 ~ 24549300 (+) True G100956
TU126093 lncRNA downstream 567123 24528760 ~ 24537309 (+) True G100962
TU126086 lncRNA downstream 581848 24543485 ~ 24549300 (+) False G100956
TU126137 lncRNA downstream 634837 24596474 ~ 24597817 (+) True G100998
AMCG00015829 mRNA upstream 79172 23747430 ~ 23760626 (+) True AMCG00015829
AMCG00015822 mRNA upstream 106118 23713609 ~ 23733680 (+) True AMCG00015822
AMCG00015824 mRNA upstream 368095 23460327 ~ 23471703 (+) True AMCG00015824
AMCG00015823 mRNA upstream 385902 23413178 ~ 23453896 (+) True AMCG00015823
AMCG00015826 mRNA upstream 447319 23368196 ~ 23392479 (+) True AMCG00015826
AMCG00015830 mRNA downstream 27602 23989239 ~ 23998009 (+) True AMCG00015830
AMCG00015833 mRNA downstream 276183 24237820 ~ 24265831 (+) True AMCG00015833
AMCG00015834 mRNA downstream 328732 24290369 ~ 24306093 (+) True AMCG00015834
AMCG00015835 mRNA downstream 383987 24345624 ~ 24353418 (+) True AMCG00015835
AMCG00015837 mRNA downstream 453487 24415124 ~ 24439833 (+) True AMCG00015837
TU125724 other upstream 1159025 22680210 ~ 22680773 (+) False AMCG00015796
TU125356 other upstream 3571513 20267407 ~ 20268285 (+) True G100338
TU125009 other upstream 5067832 18744887 ~ 18771966 (+) True AMCG00015725
TU124919 other upstream 5513894 18320056 ~ 18325904 (+) True G100007
TU124723 other upstream 6708049 17098459 ~ 17131749 (+) False AMCG00015703
TU126202 other downstream 903452 24865089 ~ 24865552 (+) True G101061
TU126442 other downstream 2302278 26263915 ~ 26264308 (+) True G101248
TU126474 other downstream 2411516 26373153 ~ 26377699 (+) True G101275
TU126639 other downstream 3928915 27890552 ~ 27992014 (+) False G101400
TU126748 other downstream 4615863 28577500 ~ 28580829 (+) True AMCG00015901

Expression Profile