RNA id: AMCG00017153



Basic Information


Item Value
RNA id AMCG00017153
length 243
RNA type mRNA
GC content 0.48
exon number 2
gene id AMCG00017153
representative True

Chromosome Information


Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 48216639 ~ 48217459 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATGTCGAGAAGAGTCTCTGTTACGAGCTTGACAGCACAACATCAGAAGGTGGATGATTTGATAGAAACGATGGCTGGGCAGTCGATGAAGTTGCTGGCACAGAGGCGTGCTGAGCTGGAGAGATGCGAGTGTCTGGGAGACGAGGTCCTTCAGTCTTCCAAGCAGTTCCAGAGGGTTTCCAGGAAAAATACTCGGAAATATAAATGGAAGAACATGTGCATCCTCTGTACATGCTGCTGTTAA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU23178 lncRNA downstream 45529 48170158 ~ 48171110 (-) True G18690
TU23134 lncRNA downstream 151600 48062312 ~ 48065039 (-) True G18652
TU23133 lncRNA downstream 162017 48054208 ~ 48054622 (-) True G18651
TU23024 lncRNA downstream 589118 47627263 ~ 47627521 (-) True G18559
TU22995 lncRNA downstream 788554 47426247 ~ 47428085 (-) True G18533
TU23194 lncRNA upstream 6591 48224050 ~ 48224318 (-) True G18702
TU23201 lncRNA upstream 15231 48232690 ~ 48237413 (-) True G18709
TU23365 lncRNA upstream 1143209 49360668 ~ 49360937 (-) True G18827
TU23366 lncRNA upstream 1144201 49361660 ~ 49361926 (-) True G18828
TU23367 lncRNA upstream 1146290 49363749 ~ 49364302 (-) True G18829
AMCG00017149 mRNA downstream 4153 48175212 ~ 48212486 (-) True AMCG00017149
AMCG00017145 mRNA downstream 46964 48160403 ~ 48169675 (-) True AMCG00017145
AMCG00017146 mRNA downstream 58242 48148754 ~ 48158397 (-) True AMCG00017146
AMCG00017141 mRNA downstream 250048 47965527 ~ 47966591 (-) True AMCG00017141
AMCG00017139 mRNA downstream 494379 47669761 ~ 47722260 (-) True AMCG00017139
AMCG00017150 mRNA upstream 7705 48225164 ~ 48232148 (-) True AMCG00017150
AMCG00017152 mRNA upstream 22625 48240084 ~ 48241492 (-) True AMCG00017152
AMCG00017148 mRNA upstream 31895 48249354 ~ 48261026 (-) True AMCG00017148
AMCG00017151 mRNA upstream 106356 48323815 ~ 48345751 (-) True AMCG00017151
AMCG00017158 mRNA upstream 275508 48492967 ~ 48494407 (-) False AMCG00017158
TU22128 other downstream 5352023 42808711 ~ 42864616 (-) True G17842
TU21619 other downstream 6999408 41216651 ~ 41217231 (-) True G17421
TU21144 other downstream 10157700 38027483 ~ 38058939 (-) False AMCG00016959
TU21143 other downstream 10157700 38054665 ~ 38058939 (-) False AMCG00016959
TU21119 other downstream 10458168 37758157 ~ 37758471 (-) True G17032
TU23267 other upstream 271668 48489127 ~ 48494349 (-) True AMCG00017158
TU23976 other upstream 3213396 51430855 ~ 51435068 (-) False AMCG00017234
TU23984 other upstream 3228128 51445587 ~ 51449786 (-) True G19335
TU23985 other upstream 3228128 51445587 ~ 51449786 (-) False G19335
TU24132 other upstream 3638787 51856246 ~ 51860142 (-) False AMCG00017251

Expression Profile


AMCG00017153 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

AMCG00017153 Expression in each Bioproject

Bar chart with 3 bars.
AMCG00017153 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.