RNA id: TU18746


Basic Information

Item Value
RNA id TU18746
length 268
lncRNA type inter_gene
GC content 0.52
exon number 1
gene id G15075
representative True

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 27424554 ~ 27424821 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

caccgatcagccataacattatgaccacctgcctaatattgtgtaggtccctcttttgccgccaaaacagccctgacccgtcgaggcatggactccactagacctctgaaggtgtgctgtggtatctggcaccaagacgttagcagcagatcctttaagtcctgtaagttgcgaggtggggcctccatggatcggacttgtttgtccagcacatcccacagatgctcgattggattgagatctggggaatttggaggccaagtcaaca

Function

GO:

id name namespace
GO:0009799 specification of symmetry biological_process
GO:0007507 heart development biological_process
GO:0009855 determination of bilateral symmetry biological_process
GO:0007368 determination of left/right symmetry biological_process
GO:0061371 determination of heart left/right asymmetry biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU18745 lncRNA downstream 8015 27416249 ~ 27416539 (-) True G15074
TU18744 lncRNA downstream 8662 27415653 ~ 27415892 (-) True G15073
TU18742 lncRNA downstream 11325 27413000 ~ 27413229 (-) True G15071
TU18737 lncRNA downstream 25971 27395119 ~ 27398583 (-) True G15066
TU18659 lncRNA downstream 115596 27296085 ~ 27308958 (-) True G15016
TU18755 lncRNA upstream 110504 27535325 ~ 27541840 (-) True G15079
TU18775 lncRNA upstream 125491 27550312 ~ 27553162 (-) True G15095
TU18848 lncRNA upstream 369771 27794592 ~ 27794980 (-) True G15165
TU18849 lncRNA upstream 371962 27796783 ~ 27797008 (-) True G15166
TU18858 lncRNA upstream 377308 27802129 ~ 27805042 (-) True G15172
AMCG00016675 mRNA downstream 43466 27375965 ~ 27381088 (-) True AMCG00016675
AMCG00016670 mRNA downstream 48854 27370979 ~ 27375700 (-) True AMCG00016670
AMCG00016669 mRNA downstream 84961 27338007 ~ 27339593 (-) True AMCG00016669
AMCG00016672 mRNA downstream 111381 27299603 ~ 27313173 (-) True AMCG00016672
AMCG00016673 mRNA downstream 133693 27286874 ~ 27290861 (-) True AMCG00016673
AMCG00016681 mRNA upstream 5281 27430102 ~ 27433860 (-) True AMCG00016681
AMCG00016688 mRNA upstream 84824 27509645 ~ 27516973 (-) True AMCG00016688
AMCG00016692 mRNA upstream 218818 27643639 ~ 27650849 (-) True AMCG00016692
AMCG00016693 mRNA upstream 230927 27655748 ~ 27669412 (-) True AMCG00016693
AMCG00016694 mRNA upstream 276191 27701012 ~ 27707529 (-) True AMCG00016694
TU18738 other downstream 20632 27401676 ~ 27403922 (-) True G15067
TU18673 other downstream 54415 27369590 ~ 27370139 (-) True G15026
TU18636 other downstream 145220 27268820 ~ 27279334 (-) True AMCG00016671
TU18445 other downstream 852913 26568669 ~ 26571641 (-) True G14843
TU18749 other upstream 72 27424893 ~ 27428651 (-) True G15076
TU19143 other upstream 1356651 28781472 ~ 28785507 (-) True AMCG00016732
TU19522 other upstream 2776638 30201459 ~ 30202351 (-) True G15706
TU19613 other upstream 3101471 30526292 ~ 30529500 (-) True G15787
TU20184 other upstream 4998237 32423058 ~ 32423438 (-) True G16247

Expression Profile