RNA id: TU22853


Basic Information

Item Value
RNA id TU22853
length 272
lncRNA type intronic
GC content 0.50
exon number 1
gene id G18421
representative True

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 46563931 ~ 46564202 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ctaatattgtgtaggtcccccttttgccgccaaaacagccctgacctgtcgaggcatggactccactagacctctgaaggtgtgctgtggtatctggcaccaagacgttagcagcagatcctttaagtcctgtaagttgcgaggtggggcctccatggatcggacttgtttgtccagcacatcccacagatgctcgattggattgagatctggggaagtcaacaccttgaacttgttgttatgttcctcaaaccattcctgaaccatttttg

Function

GO:

id name namespace
GO:0006091 generation of precursor metabolites and energy biological_process

KEGG:

id description
ko00020 Citrate cycle (TCA cycle)
ko00620 Pyruvate metabolism

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU22851 lncRNA downstream 358 46563094 ~ 46563573 (-) True G18419
TU22837 lncRNA downstream 109535 46440069 ~ 46454396 (-) True G18405
TU22792 lncRNA downstream 457338 46102262 ~ 46106593 (-) True G18366
TU22790 lncRNA downstream 461743 46101960 ~ 46102188 (-) True G18364
TU22760 lncRNA downstream 647311 45853062 ~ 45916620 (-) True G18352
TU22974 lncRNA upstream 610444 47174646 ~ 47308372 (-) True G18519
TU22976 lncRNA upstream 613846 47178048 ~ 47196175 (-) False G18519
TU22990 lncRNA upstream 823696 47387898 ~ 47388821 (-) True G18529
TU22995 lncRNA upstream 862045 47426247 ~ 47428085 (-) True G18533
TU23024 lncRNA upstream 1063061 47627263 ~ 47627521 (-) True G18559
AMCG00017115 mRNA downstream 160630 46386418 ~ 46403301 (-) True AMCG00017115
AMCG00017116 mRNA downstream 181063 46372466 ~ 46382868 (-) True AMCG00017116
AMCG00017111 mRNA downstream 664085 45867027 ~ 45899846 (-) True AMCG00017111
AMCG00017110 mRNA downstream 898270 45662634 ~ 45665661 (-) True AMCG00017110
AMCG00017109 mRNA downstream 916713 45623126 ~ 45647218 (-) True AMCG00017109
AMCG00017126 mRNA upstream 342291 46906493 ~ 46916078 (-) True AMCG00017126
AMCG00017125 mRNA upstream 354158 46918360 ~ 46930810 (-) True AMCG00017125
AMCG00017132 mRNA upstream 483071 47047273 ~ 47051406 (-) True AMCG00017132
AMCG00017137 mRNA upstream 958580 47522782 ~ 47541031 (-) True AMCG00017137
AMCG00017136 mRNA upstream 977891 47542093 ~ 47550598 (-) True AMCG00017136
TU22128 other downstream 3699315 42808711 ~ 42864616 (-) True G17842
TU21619 other downstream 5346700 41216651 ~ 41217231 (-) True G17421
TU21144 other downstream 8504992 38027483 ~ 38058939 (-) False AMCG00016959
TU21143 other downstream 8504992 38054665 ~ 38058939 (-) False AMCG00016959
TU21119 other downstream 8805460 37758157 ~ 37758471 (-) True G17032
TU23267 other upstream 1924925 48489127 ~ 48494349 (-) True AMCG00017158
TU23976 other upstream 4866653 51430855 ~ 51435068 (-) False AMCG00017234
TU23984 other upstream 4881385 51445587 ~ 51449786 (-) True G19335
TU23985 other upstream 4881385 51445587 ~ 51449786 (-) False G19335
TU24132 other upstream 5292044 51856246 ~ 51860142 (-) False AMCG00017251

Expression Profile