RNA id: TU116944



Basic Information


Item Value
RNA id TU116944
length 310
lncRNA type inter_gene
GC content 0.46
exon number 1
gene id G93718
representative True

Chromosome Information


Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 25809544 ~ 25809853 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


cttgatccaagtcttcaaaatcatgaagggcatcgaccacatcaaaccagaggagcttttccagatcagcagggacacacgcacccggggacacaaatggaaattgggcttcaaggcattcaagacagaaaacaggagacacttcttcacacagagaggcgtcacaatctgaacaaactccccagcgatgtggttgaagctgaaagtttgggaacatttaaaaatagactggataggatccttggatcacttagatattaatggacaccaaacgagcacgatgggtcgaatggcctcctctcgtttgtaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU116912 lncRNA downstream 291944 25517286 ~ 25517600 (-) True G93689
TU116881 lncRNA downstream 428506 25372933 ~ 25381038 (-) True G93660
TU116853 lncRNA downstream 698454 25110890 ~ 25111090 (-) True G93641
TU116851 lncRNA downstream 702462 25106802 ~ 25107082 (-) True G93639
TU116811 lncRNA downstream 799940 25007684 ~ 25009604 (-) False AMCG00017844
TU116972 lncRNA upstream 135288 25945141 ~ 25946954 (-) False AMCG00017861
TU116973 lncRNA upstream 137382 25947235 ~ 25948594 (-) False AMCG00017861
TU117044 lncRNA upstream 448243 26258096 ~ 26258367 (-) True G93802
TU117058 lncRNA upstream 543664 26353517 ~ 26353724 (-) True G93816
TU117088 lncRNA upstream 689061 26498914 ~ 26499177 (-) True G93843
AMCG00017855 mRNA downstream 442994 25346820 ~ 25366550 (-) True AMCG00017855
AMCG00017852 mRNA downstream 585263 25115938 ~ 25224281 (-) True AMCG00017852
AMCG00017850 mRNA downstream 704402 25100833 ~ 25105142 (-) True AMCG00017850
AMCG00017851 mRNA downstream 708913 25095198 ~ 25100631 (-) True AMCG00017851
AMCG00017846 mRNA downstream 729113 25075605 ~ 25080431 (-) True AMCG00017846
AMCG00017862 mRNA upstream 13123 25822976 ~ 25923225 (-) True AMCG00017862
AMCG00017861 mRNA upstream 135907 25945760 ~ 25957648 (-) True AMCG00017861
AMCG00017866 mRNA upstream 202635 26012488 ~ 26015942 (-) True AMCG00017866
AMCG00017867 mRNA upstream 223262 26033115 ~ 26049947 (-) True AMCG00017867
AMCG00017869 mRNA upstream 266875 26076728 ~ 26082767 (-) True AMCG00017869
TU116215 other downstream 2487590 23318126 ~ 23321954 (-) True AMCG00017780
TU116216 other downstream 2487590 23318126 ~ 23321954 (-) False AMCG00017780
TU116217 other downstream 2487590 23318126 ~ 23321954 (-) False AMCG00017780
TU115494 other downstream 6390188 19412987 ~ 19419356 (-) False G92591
TU116981 other upstream 202808 26012661 ~ 26015492 (-) False AMCG00017866
TU116982 other upstream 202808 26012661 ~ 26015492 (-) False AMCG00017866
TU117033 other upstream 294173 26104026 ~ 26107805 (-) True G93795
TU117034 other upstream 299207 26109060 ~ 26110074 (-) True G93796
TU117337 other upstream 2293446 28103299 ~ 28144589 (-) True AMCG00017906

Expression Profile


TU116944 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

TU116944 Expression in each Bioproject

Bar chart with 7 bars.
TU116944 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.