RNA id: TU117993



Basic Information


Item Value
RNA id TU117993
length 205
lncRNA type inter_gene
GC content 0.40
exon number 1
gene id G94600
representative True

Chromosome Information


Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 31516832 ~ 31517036 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


agactgattggtctgtaatttcctggctcagttttgtcccctttcttgtggattggtttgacatttgctgtcttccagtcagttggcacatcccctgttctaagtgtcatttggaataattgagttagcggcctataaataatttccctaatttctttaagtactgttggaaatatcccatctggcccaggtgatgtgtttgttt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU117991 lncRNA downstream 58578 31457879 ~ 31458254 (-) True G94598
TU117982 lncRNA downstream 136607 31379255 ~ 31380225 (-) True G94590
TU117983 lncRNA downstream 136607 31379255 ~ 31380225 (-) False G94590
TU117968 lncRNA downstream 536280 30979895 ~ 30980552 (-) True G94577
TU117953 lncRNA downstream 795330 30718352 ~ 30721502 (-) True G94563
TU118024 lncRNA upstream 104564 31621600 ~ 31622378 (-) True G94622
TU118061 lncRNA upstream 224188 31741224 ~ 31741659 (-) True G94655
TU118071 lncRNA upstream 311423 31828459 ~ 31828800 (-) True G94665
TU118171 lncRNA upstream 675147 32192183 ~ 32196606 (-) True G94747
TU118233 lncRNA upstream 828214 32345250 ~ 32346583 (-) True G94791
AMCG00017979 mRNA downstream 533929 30981050 ~ 30982903 (-) True AMCG00017979
AMCG00017975 mRNA downstream 668603 30832793 ~ 30848229 (-) True AMCG00017975
AMCG00017974 mRNA downstream 705497 30810404 ~ 30811335 (-) True AMCG00017974
AMCG00017976 mRNA downstream 740391 30744971 ~ 30776441 (-) True AMCG00017976
AMCG00017977 mRNA downstream 794782 30658626 ~ 30722050 (-) True AMCG00017977
AMCG00017983 mRNA upstream 82622 31599658 ~ 31607699 (-) True AMCG00017983
AMCG00017984 mRNA upstream 105909 31622945 ~ 31644198 (-) True AMCG00017984
AMCG00017986 mRNA upstream 175291 31692327 ~ 31715433 (-) True AMCG00017986
AMCG00017987 mRNA upstream 345693 31862729 ~ 31883678 (-) True AMCG00017987
AMCG00017988 mRNA upstream 375437 31892473 ~ 31894806 (-) True AMCG00017988
TU117930 other downstream 858339 30627988 ~ 30658493 (-) True G94543
TU117547 other downstream 2243664 29269235 ~ 29273168 (-) True G94238
TU117465 other downstream 2640909 28874161 ~ 28875923 (-) True G94172
TU117337 other downstream 3372243 28103299 ~ 28144589 (-) True AMCG00017906
TU117034 other downstream 5406758 26109060 ~ 26110074 (-) True G93796
TU118224 other upstream 745740 32262776 ~ 32263531 (-) False AMCG00018000
TU118225 other upstream 754658 32271694 ~ 32276372 (-) True AMCG00018004
TU118217 other upstream 776984 32294020 ~ 32295433 (-) False AMCG00018007
TU118287 other upstream 938049 32455085 ~ 32456410 (-) True G94835
TU118334 other upstream 1085882 32602918 ~ 32605751 (-) False AMCG00018021

Expression Profile


TU117993 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

TU117993 Expression in each Bioproject

Bar chart with 5 bars.
TU117993 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.