RNA id: AMCG00018045


Basic Information

Item Value
RNA id AMCG00018045
length 372
RNA type mRNA
GC content 0.65
exon number 2
gene id AMCG00018045
representative True

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 429053 ~ 430631 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGTCCGGCGTGGTGCGCACCCTGAGCCGCTGCCTGCTGCCCGCGGAAGCCAGCCGGGAGCGGAGCGGCAGCAAGGAGCGCAGCCGGGACCGGGACGCCAACCAGGAGCGGGAGGCGAGGCGCCGCAGCCGGGAGATCGACTCTATGCTGGCCCGTGAGAGGCGCTCCATCCGCCGCCTGGTCAAGATCCTGCTCCTGGGGGCCGGGGAGAGTGGGAAGTCCACTTTCCTGAAGCAGATGCGGATTATCCACGGCAAGGAGTTCGACCAGAAAGCGCTGCTGGACTTCCGAGATACCATCTTCGAGAACATCATCAAGCCGCTGTTAGGAGACCCCTGTACAAGACTAGGGATCGTGGTTTCCCAGGACTAG

Function

GO:

id name namespace
GO:0042074 cell migration involved in gastrulation biological_process
GO:0007188 adenylate cyclase-modulating G protein-coupled receptor signaling pathway biological_process
GO:0009826 unidimensional cell growth biological_process
GO:0007266 Rho protein signal transduction biological_process
GO:0032956 regulation of actin cytoskeleton organization biological_process
GO:0006184 obsolete GTP catabolic process biological_process
GO:2000048 negative regulation of cell-cell adhesion mediated by cadherin biological_process
GO:0043149 stress fiber assembly biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0031526 brush border membrane cellular_component
GO:0005834 heterotrimeric G-protein complex cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0004871 obsolete signal transducer activity molecular_function
GO:0031683 G-protein beta/gamma-subunit complex binding molecular_function
GO:0031752 D5 dopamine receptor binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU142757 lncRNA downstream 38157 468788 ~ 472124 (+) True G114018
TU142803 lncRNA downstream 122579 553210 ~ 553504 (+) True G114056
TU143011 lncRNA downstream 732261 1162892 ~ 1178095 (+) True G114205
TU143047 lncRNA downstream 836209 1266840 ~ 1268893 (+) True G114237
TU143063 lncRNA downstream 859924 1290555 ~ 1291851 (+) True G114253
AMCG00018044 mRNA upstream 10373 391725 ~ 418680 (+) True AMCG00018044
AMCG00018038 mRNA upstream 399367 25688 ~ 29686 (+) True AMCG00018038
AMCG00018046 mRNA downstream 9559 440190 ~ 445050 (+) True AMCG00018046
AMCG00018043 mRNA downstream 34874 465505 ~ 467994 (+) True AMCG00018043
AMCG00018051 mRNA downstream 59488 490119 ~ 499466 (+) True AMCG00018051
AMCG00018050 mRNA downstream 70911 501542 ~ 513021 (+) True AMCG00018050
AMCG00018053 mRNA downstream 82709 513340 ~ 513737 (+) True AMCG00018053
TU142799 other downstream 144629 575260 ~ 579704 (+) True G114053
TU142800 other downstream 144629 575260 ~ 579704 (+) False G114053
TU142895 other downstream 346752 777383 ~ 794790 (+) True G114123
TU142941 other downstream 440714 871345 ~ 878979 (+) False AMCG00018072
TU143029 other downstream 789148 1219779 ~ 1220216 (+) True G114219

Expression Profile