RNA id: TCONS_00009388


Basic Information

Item Value
RNA id TCONS_00009388
length 434
RNA type mRNA
GC content 0.47
exon number 3
gene id XLOC_004742
representative False

Chromosome Information

Item Value
chromosome id NC_007123.7
NCBI id CM002896.2
chromosome length 49182954
location 26434478 ~ 26461744 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTACAGAGGTTCCTGTAAATGCTTCAGGCTCCATCACAGTCCAATCTCTCAATAATCTCCATCCTGGCCCACAATTTTCTACAGTATCAAGGCCATCTGGTTGCAGGTATAGGCAACAGTTCCAGAACCCGCGGCAAATGTTCGTGAGTCGATCCCTCATATGCCCCCTCCCTCGAAAACAAGCTTTTACCACAATTTACTCTATATTTGGTGTTGGTCTGATGTCTGTGCTGGACCGTAAAGGAAAGGAAGAGGAGGGCGCAGACTGCACAAACCACCGGTGAAGTAGAGGAGAACAGCGATAACAACGATGGAGGAAACTTCAGCCAAACTCTTCAGCTTATGGATTTACTGTGTAATTATTTTCCTATCTGATGTTGGACTAGGTTCTAACGTCTGTACTTCTCGAGGAGCCAGTACATGTCAGCAGTGCC

Function

GO:

id name namespace
GO:0070527 platelet aggregation biological_process
GO:0007229 integrin-mediated signaling pathway biological_process
GO:0016477 cell migration biological_process
GO:0007155 cell adhesion biological_process
GO:0007160 cell-matrix adhesion biological_process
GO:0033627 cell adhesion mediated by integrin biological_process
GO:0005925 focal adhesion cellular_component
GO:0008305 integrin complex cellular_component
GO:0009986 cell surface cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005515 protein binding molecular_function
GO:0070051 fibrinogen binding molecular_function
GO:0005178 integrin binding molecular_function
GO:0001968 fibronectin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-071207-2 Predicted to enable fibronectin binding activity and integrin binding activity. Predicted to contribute to fibrinogen binding activity. Predicted to be involved in several processes, including cell adhesion mediated by integrin; cell-matrix adhesion; and integrin-mediated signaling pathway. Predicted to act upstream of or within platelet aggregation. Part of integrin complex. Is expressed in brain; cardiovascular system; dental epithelium; digestive system; and pectoral fin fold. Human ortholog(s) of this gene implicated in several diseases, including acute myeloid leukemia; autoimmune thrombocytopenic purpura; blood platelet disease (multiple); end stage renal disease; and non-arteritic anterior ischemic optic neuropathy. Orthologous to human ITGB3 (integrin subunit beta 3).

Ensembl:

ensembl_id ENSDART00000150048

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00010742 lncRNA upstream 930098 25502406 ~ 25504380 (+) True XLOC_004735
TCONS_00009377 lncRNA upstream 961272 25432626 ~ 25473206 (+) False XLOC_004734
TCONS_00010939 lncRNA upstream 1025958 25380168 ~ 25408520 (+) False XLOC_004733
TCONS_00010741 lncRNA upstream 1044887 25382277 ~ 25389591 (+) True XLOC_004733
TCONS_00010740 lncRNA upstream 1046808 25380137 ~ 25387670 (+) False XLOC_004733
TCONS_00010940 lncRNA downstream 52101 26489353 ~ 26491973 (+) True XLOC_004744
TCONS_00010942 lncRNA downstream 152392 26589644 ~ 26593298 (+) False XLOC_004748
TCONS_00010941 lncRNA downstream 152392 26589644 ~ 26593298 (+) True XLOC_004748
TCONS_00010943 lncRNA downstream 200875 26638127 ~ 26725781 (+) False XLOC_004750
TCONS_00010743 lncRNA downstream 254567 26691819 ~ 26692051 (+) True XLOC_004751
TCONS_00009387 mRNA upstream 485999 25945560 ~ 25948479 (+) True XLOC_004741
TCONS_00009386 mRNA upstream 552534 25845494 ~ 25881944 (+) True XLOC_004740
TCONS_00009384 mRNA upstream 604210 25775734 ~ 25830268 (+) False XLOC_004739
TCONS_00009385 mRNA upstream 605460 25775814 ~ 25829018 (+) True XLOC_004739
TCONS_00009382 mRNA upstream 664246 25640480 ~ 25770232 (+) True XLOC_004737
TCONS_00009390 mRNA downstream 30595 26467847 ~ 26487363 (+) False XLOC_004743
TCONS_00009391 mRNA downstream 34460 26471712 ~ 26486482 (+) True XLOC_004743
TCONS_00009392 mRNA downstream 54385 26491637 ~ 26494851 (+) True XLOC_004745
TCONS_00009393 mRNA downstream 75317 26512569 ~ 26525699 (+) True XLOC_004746
TCONS_00009394 mRNA downstream 101609 26538861 ~ 26547248 (+) True XLOC_004747
TCONS_00009383 other upstream 786235 25648127 ~ 25648243 (+) True XLOC_004738
TCONS_00009380 other upstream 956572 25468312 ~ 25477906 (+) True XLOC_004734
TCONS_00009372 other upstream 1182691 25223799 ~ 25251787 (+) False XLOC_004732
TCONS_00009364 other upstream 1868886 24565478 ~ 24565592 (+) True XLOC_004724
TCONS_00009361 other upstream 2016138 24418224 ~ 24418340 (+) True XLOC_004723
TCONS_00009419 other downstream 697617 27134869 ~ 27134967 (+) True XLOC_004762
TCONS_00009421 other downstream 719691 27156943 ~ 27163064 (+) False XLOC_004764
TCONS_00009426 other downstream 781741 27218993 ~ 27220589 (+) True XLOC_004765
TCONS_00009428 other downstream 794043 27231295 ~ 27234421 (+) False XLOC_004766
TCONS_00009459 other downstream 2508280 28945532 ~ 28945646 (+) True XLOC_004786

Expression Profile

//