RNA id: TU147593


Basic Information

Item Value
RNA id TU147593
length 404
RNA type TUCP
GC content 0.51
exon number 1
gene id G117784
representative True

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 17008898 ~ 17009301 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

caccgatcagccataacattatgaccactgacagctgaagtgaataacactgataatctcgttatcatggcacctgtcagtgggtgggatatattaggcagcaagtgaacattttgtcctcaaagttgatgtgttagaagcaggaaaaatgggcaagcgtaaggatctgagcgactttgacaagggccaaattgtgatggctagacgactgggtcagagcatctccaaaactgcagctcttgtggggtgttcccggtctgcagtggtcagtacctatcaaaagtggtccaaggaaggaaaagcagtgaaccggcgacagggtcatgggcggccaaggctcattgatgcacgtggggagcgaaggctggcccgtgtggtccgatccaacagacgagctactgtag

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU147479 lncRNA downstream 712453 16294830 ~ 16296445 (-) True G117710
TU147400 lncRNA downstream 983825 16022598 ~ 16025073 (-) True G117646
TU147288 lncRNA downstream 1490717 15498662 ~ 15518181 (-) True AMCG00018617
TU147286 lncRNA downstream 1490717 15516554 ~ 15518181 (-) False AMCG00018617
TU147287 lncRNA downstream 1492616 15498662 ~ 15516282 (-) False AMCG00018617
TU147623 lncRNA upstream 144701 17154002 ~ 17155261 (-) True G117809
TU147680 lncRNA upstream 456833 17466134 ~ 17466434 (-) True G117853
TU147683 lncRNA upstream 505556 17514857 ~ 17515120 (-) True G117856
TU147721 lncRNA upstream 575450 17584751 ~ 17585098 (-) True G117888
TU147764 lncRNA upstream 725375 17734676 ~ 17736324 (-) True G117916
AMCG00018649 mRNA downstream 31815 16963043 ~ 16977083 (-) True AMCG00018649
AMCG00018651 mRNA downstream 85304 16912767 ~ 16923594 (-) True AMCG00018651
AMCG00018646 mRNA downstream 260937 16747653 ~ 16747961 (-) True AMCG00018646
AMCG00018645 mRNA downstream 523310 16464741 ~ 16485588 (-) True AMCG00018645
AMCG00018644 mRNA downstream 546535 16438631 ~ 16462363 (-) True AMCG00018644
AMCG00018650 mRNA upstream 58911 17068212 ~ 17070690 (-) True AMCG00018650
AMCG00018652 mRNA upstream 146919 17156220 ~ 17168116 (-) True AMCG00018652
AMCG00018653 mRNA upstream 169788 17179089 ~ 17224239 (-) True AMCG00018653
AMCG00018656 mRNA upstream 258288 17267589 ~ 17290539 (-) True AMCG00018656
AMCG00018658 mRNA upstream 288963 17298264 ~ 17304621 (-) True AMCG00018658
TU147284 other downstream 1490717 15498662 ~ 15518181 (-) False AMCG00018617
TU147285 other downstream 1492616 15498662 ~ 15516282 (-) False AMCG00018617
TU147067 other downstream 2270586 14736138 ~ 14738312 (-) True G117377
TU146918 other downstream 2488023 14503403 ~ 14520875 (-) True G117267
TU146385 other downstream 3753129 13253085 ~ 13255769 (-) False AMCG00018522
TU147639 other upstream 216789 17226090 ~ 17256271 (-) True G117823
TU147640 other upstream 216789 17226090 ~ 17256271 (-) False G117823
TU147734 other upstream 594055 17603356 ~ 17603848 (-) True G117899
TU147953 other upstream 1457067 18466368 ~ 18474245 (-) True G118075
TU148096 other upstream 2036381 19045682 ~ 19047577 (-) False AMCG00018723

Expression Profile