RNA id: AMCG00019993


Basic Information

Item Value
RNA id AMCG00019993
length 273
RNA type mRNA
GC content 0.44
exon number 2
gene id AMCG00019993
representative False

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 5276662 ~ 5278291 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

AGAAAAGATGACACTGAAGCTGGGTTCAATATGGAGAACCTGGTTATATGCTGCCTAGACTTCTTTGAAGCTGGGACTGAGACCACATCTACCACTCTGCGCTGGGGTCTCCTCTACATGATCAAGTACCCCGAGATCCAGATAATAACTAACTTCACCTCGGTGCTTTGTGACAAAAAGGAGTGGGAGACTGCAGAGACATTTAACCCCAGGCACTTTCTAGATTCAAATGGAAAGTTCTTTAAAAGGGAGTCATTCATTCCATTTTCAGCA

Function

GO:

id name namespace
GO:0055114 oxidation-reduction process biological_process
GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen molecular_function
GO:0005506 iron ion binding molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU75188 lncRNA downstream 109374 5166359 ~ 5167290 (-) True G60102
TU75187 lncRNA downstream 111176 5165267 ~ 5165488 (-) True G60101
TU75186 lncRNA downstream 112669 5163764 ~ 5163995 (-) True G60100
TU75185 lncRNA downstream 114143 5162006 ~ 5162521 (-) True G60099
TU75166 lncRNA downstream 119471 5155008 ~ 5157193 (-) True G60088
TU75287 lncRNA upstream 193393 5471319 ~ 5523619 (-) True G60179
TU75342 lncRNA upstream 713019 5990945 ~ 5991184 (-) True G60230
TU75343 lncRNA upstream 717543 5995469 ~ 5995688 (-) True G60231
TU75347 lncRNA upstream 758639 6036565 ~ 6040665 (-) True G60235
TU75349 lncRNA upstream 777623 6055549 ~ 6055822 (-) True G60237
AMCG00019987 mRNA downstream 42210 5234230 ~ 5234454 (-) True AMCG00019987
AMCG00019984 mRNA downstream 46526 5207773 ~ 5230138 (-) True AMCG00019984
AMCG00019985 mRNA downstream 69784 5167366 ~ 5206880 (-) True AMCG00019985
AMCG00019982 mRNA downstream 117344 5158359 ~ 5159320 (-) True AMCG00019982
AMCG00019983 mRNA downstream 123611 5132046 ~ 5153053 (-) True AMCG00019983
AMCG00019992 mRNA upstream 13666 5291592 ~ 5292616 (-) True AMCG00019992
AMCG00019989 mRNA upstream 19527 5297453 ~ 5301869 (-) True AMCG00019989
AMCG00019990 mRNA upstream 97940 5375866 ~ 5380964 (-) True AMCG00019990
AMCG00019994 mRNA upstream 290592 5568518 ~ 5574686 (-) True AMCG00019994
AMCG00019996 mRNA upstream 326517 5604443 ~ 5615456 (-) True AMCG00019996
TU75216 other downstream 10739 5263914 ~ 5265925 (-) True G60118
TU75113 other downstream 215387 5012444 ~ 5061277 (-) True AMCG00019976
TU74813 other downstream 1796555 3479782 ~ 3480109 (-) True G59806
TU74745 other downstream 2093598 3166237 ~ 3183066 (-) False AMCG00019942
TU74744 other downstream 2093598 3178041 ~ 3183066 (-) True AMCG00019942
TU75228 other upstream 13664 5291590 ~ 5292673 (-) False AMCG00019992
TU75483 other upstream 1172696 6450622 ~ 6453598 (-) False AMCG00020017
TU75489 other upstream 1185622 6463548 ~ 6466586 (-) False G60348
TU75492 other upstream 1185622 6463548 ~ 6466586 (-) False G60348
TU75494 other upstream 1190362 6468288 ~ 6471434 (-) True AMCG00020019

Expression Profile