RNA id: AMCG00020953


Basic Information

Item Value
RNA id AMCG00020953
length 429
RNA type mRNA
GC content 0.54
exon number 3
gene id AMCG00020953
representative True

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 37968172 ~ 38030972 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGCTGGCCGTCACACAGAGGACATCCACTGAGGTCCAGAGCTCGCAGGATGTTTTGCTCAACTGCCATTTGCCTGTTATCACGATGGTCGCCCCCAGGGGCACCACCAGCACCCCCATAATGAGGTCTGCACAGGCCAGGGACATGATGAAGATGTTGGTGGAAGTCTGCAGCTGGGAGAAGCGTGCAATAGCAATGATCACCAGCAGATTGCCCAGCACGATAATCAGGATGATGAGGGCCATCAGCAAACCCCAAGGCCAGTCTCGTTTCGAGGAGTACGTGCAAGTCGATGTGACATCACATGTCATTATCCGCCCAGCTGCCAGCCAAAGAGAAAAGTGGTGCCCAGATGTGCAGCTGTCACTCATGGGTGCTAGGGGTGAACACGTCAAACCAGACTACGCCACTTCCATCACACCCAATTAG

Function

GO:

id name namespace
GO:0007189 adenylate cyclase-activating G protein-coupled receptor signaling pathway biological_process
GO:0071875 adrenergic receptor signaling pathway biological_process
GO:0045823 positive regulation of heart contraction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004940 beta1-adrenergic receptor activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU83511 lncRNA downstream 68294 37899467 ~ 37899878 (-) True G66817
TU83474 lncRNA downstream 228975 37736763 ~ 37739197 (-) True G66786
TU83423 lncRNA downstream 472802 37495123 ~ 37495370 (-) True G66740
TU83352 lncRNA downstream 699949 37267782 ~ 37268223 (-) True G66685
TU83275 lncRNA downstream 948376 37013981 ~ 37019796 (-) True G66613
TU83550 lncRNA upstream 150065 38181037 ~ 38181274 (-) True G66851
TU83575 lncRNA upstream 247022 38277994 ~ 38278539 (-) True G66872
TU83634 lncRNA upstream 664020 38694992 ~ 38697487 (-) True G66920
TU83640 lncRNA upstream 676300 38707272 ~ 38732240 (-) True G66926
TU83642 lncRNA upstream 693319 38724291 ~ 38772808 (-) False G66927
AMCG00020949 mRNA downstream 75832 37842900 ~ 37892340 (-) True AMCG00020949
AMCG00020947 mRNA downstream 146309 37815894 ~ 37821863 (-) True AMCG00020947
AMCG00020948 mRNA downstream 153275 37772151 ~ 37814897 (-) True AMCG00020948
AMCG00020943 mRNA downstream 335680 37631777 ~ 37632492 (-) False AMCG00020943
AMCG00020940 mRNA downstream 402052 37556580 ~ 37566120 (-) True AMCG00020940
AMCG00020952 mRNA upstream 64130 38095102 ~ 38095590 (-) True AMCG00020952
AMCG00020958 mRNA upstream 201694 38232666 ~ 38238994 (-) True AMCG00020958
AMCG00020957 mRNA upstream 210774 38241746 ~ 38260001 (-) True AMCG00020957
AMCG00020959 mRNA upstream 247663 38278635 ~ 38300419 (-) True AMCG00020959
AMCG00020961 mRNA upstream 335155 38366127 ~ 38410862 (-) True AMCG00020961
TU83462 other downstream 335596 37631800 ~ 37632576 (-) True AMCG00020943
TU83289 other downstream 900380 37065163 ~ 37067792 (-) False AMCG00020922
TU83279 other downstream 922233 37040447 ~ 37045939 (-) False AMCG00020923
TU83060 other downstream 1981476 35975764 ~ 35986696 (-) False AMCG00020900
TU82986 other downstream 2148342 35813969 ~ 35819830 (-) True AMCG00020887
TU83728 other upstream 1019244 39050216 ~ 39104867 (-) False AMCG00020970
TU84154 other upstream 3569429 41600401 ~ 41602270 (-) False AMCG00021012

Expression Profile