Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ecological fish

RNA id: TU74165

Basic Information

Item	Value
RNA id	TU74165
length	216
lncRNA type	intronic
GC content	0.53
exon number	1
gene id	G59304
representative	True

Chromosome Information

Item	Value
chromosome id	CM030127.1
NCBI id	CM030127.1
chromosome length	42978078
location	267748 ~ 267963 (+)
genome version	AmiCal1_2021_bowfin_Genome
species	bowfin (Amia calva)

Sequence

ctccgtggtccagttctgatgctcacgtgcccattgtaggcactttcggcagtggacaggggtcagcatgggcaccctgactggtctgcggctacgcagccccatacgcaacaaactgcaatgcactgtgtgttctgacacctttctatcagaaccagcattcactttttcagcaatttgagctacagtagctcatctgttggatcggaccacacg

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU74160	lncRNA	upstream	21531	245912 ~ 246217 (+)	True	G59299
TU74150	lncRNA	upstream	47373	219605 ~ 220375 (+)	True	G59289
TU74167	lncRNA	downstream	177669	445632 ~ 446858 (+)	True	G59306
TU74216	lncRNA	downstream	664338	932301 ~ 1002892 (+)	True	G59351
TU74257	lncRNA	downstream	917320	1185283 ~ 1186234 (+)	True	G59381
TU74261	lncRNA	downstream	960983	1228946 ~ 1229205 (+)	True	G59385
TU74263	lncRNA	downstream	996529	1264492 ~ 1264739 (+)	True	G59387
AMCG00019873	mRNA	upstream	164100	77166 ~ 103648 (+)	True	AMCG00019873
AMCG00019872	mRNA	upstream	192485	48107 ~ 75263 (+)	True	AMCG00019872
AMCG00019876	mRNA	downstream	13378	281341 ~ 297312 (+)	True	AMCG00019876
AMCG00019877	mRNA	downstream	117063	385026 ~ 418105 (+)	True	AMCG00019877
AMCG00019879	mRNA	downstream	305795	573758 ~ 575695 (+)	True	AMCG00019879
AMCG00019884	mRNA	downstream	806853	1074816 ~ 1108996 (+)	True	AMCG00019884
AMCG00019885	mRNA	downstream	856571	1124534 ~ 1128690 (+)	True	AMCG00019885
TU74166	other	downstream	173635	441598 ~ 445530 (+)	True	G59305
TU74243	other	downstream	807541	1075504 ~ 1078063 (+)	False	AMCG00019884
TU74774	other	downstream	2973476	3241439 ~ 3250062 (+)	False	AMCG00019934
TU75012	other	downstream	4555850	4823813 ~ 4835797 (+)	False	AMCG00019967
TU75242	other	downstream	5087809	5355772 ~ 5361863 (+)	True	G60137

Expression Profile