Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ecological fish

RNA id: TU74184

Basic Information

Item	Value
RNA id	TU74184
length	204
lncRNA type	inter_gene
GC content	0.58
exon number	1
gene id	G59322
representative	True

Chromosome Information

Item	Value
chromosome id	CM030127.1
NCBI id	CM030127.1
chromosome length	42978078
location	382652 ~ 382855 (-)
genome version	AmiCal1_2021_bowfin_Genome
species	bowfin (Amia calva)

Sequence

GTGGGGTTGTAGATCTCGTTGCTCTGGCAGCCGCTGATGGTGATCGGGTCGAAGAACTGGAAGGAGCGGAGGCCCACCCCCGATATGGCCACATAGTGGGACTTGAACCTGACAAGAATGGCCTGAGTGCGGTAGAAAGCCATGCTGAGGTCGTGGCTGACAGGGATGACCAGGGGGTTGTTTCTGCAGCTCAGTCTCCAGTCC

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU74144	lncRNA	downstream	214629	167758 ~ 168023 (-)	True	G59283
TU74141	lncRNA	downstream	283558	96833 ~ 99094 (-)	True	G59280
TU74186	lncRNA	upstream	62741	445596 ~ 446868 (-)	True	G59324
TU74226	lncRNA	upstream	164971	547826 ~ 557376 (-)	False	AMCG00019880
TU74236	lncRNA	upstream	549454	932309 ~ 958515 (-)	True	G59362
TU74264	lncRNA	upstream	881639	1264494 ~ 1264734 (-)	True	G59388
TU74266	lncRNA	upstream	901570	1284425 ~ 1284745 (-)	True	G59390
AMCG00019875	mRNA	downstream	142519	235518 ~ 240133 (-)	True	AMCG00019875
AMCG00019878	mRNA	upstream	72605	455460 ~ 481521 (-)	True	AMCG00019878
AMCG00019880	mRNA	upstream	152976	535831 ~ 572827 (-)	True	AMCG00019880
AMCG00019881	mRNA	upstream	199495	582350 ~ 593396 (-)	True	AMCG00019881
AMCG00019882	mRNA	upstream	486206	869061 ~ 870896 (-)	True	AMCG00019882
AMCG00019883	mRNA	upstream	562043	944898 ~ 945889 (-)	True	AMCG00019883
TU74284	other	upstream	1202064	1584919 ~ 1586000 (-)	True	G59408
TU74395	other	upstream	1941433	2324288 ~ 2327415 (-)	True	G59505
TU74434	other	upstream	2072056	2454911 ~ 2480799 (-)	True	G59530
TU74449	other	upstream	2112044	2494899 ~ 2507020 (-)	True	G59545
TU74667	other	upstream	2649001	3031856 ~ 3034335 (-)	True	G59712

Expression Profile

Homologous

species	RNA id	representative	length	rna type	GC content	exon number	chromosome id	location
zebrafish (Danio rerio)	TCONS_00062162	False	1309	lncRNA	0.49	4	NC_007116.7	70461478 ~ 70508199 (-)