RNA id: TU74264


Basic Information

Item Value
RNA id TU74264
length 241
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G59388
representative True

Chromosome Information

Item Value
chromosome id CM030127.1
NCBI id CM030127.1
chromosome length 42978078
location 1264494 ~ 1264734 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

aatgcaaagagcttttttcaatattacaacagcaagcggtcaataaaggaggaagtgaaacagataaagggcaaaaatggaggtatcttggaaaacgaacaagatgtggcaaatgttctaaatgagtatttcacagaggtttttacaaaagaaaaaacagatgacatgccacaggttgacaatcagtccagtcaaaccctaagagagatcaggataaatgaggaggaggtactaaagggac

Function

GO:

id name namespace
GO:0019541 propionate metabolic process biological_process
GO:0019543 propionate catabolic process biological_process
GO:0043606 formamide metabolic process biological_process
GO:0019556 histidine catabolic process to glutamate and formamide biological_process
GO:0043648 dicarboxylic acid metabolic process biological_process
GO:0019626 short-chain fatty acid catabolic process biological_process
GO:0046395 carboxylic acid catabolic process biological_process
GO:0044282 small molecule catabolic process biological_process
GO:0052803 imidazole-containing compound metabolic process biological_process
GO:0052805 imidazole-containing compound catabolic process biological_process
GO:0006536 glutamate metabolic process biological_process
GO:0006547 histidine metabolic process biological_process
GO:0046459 short-chain fatty acid metabolic process biological_process
GO:0006548 histidine catabolic process biological_process
GO:0016054 organic acid catabolic process biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU74236 lncRNA downstream 305979 932309 ~ 958515 (-) True G59362
TU74226 lncRNA downstream 707118 547826 ~ 557376 (-) False AMCG00019880
TU74186 lncRNA downstream 817626 445596 ~ 446868 (-) True G59324
TU74184 lncRNA downstream 881639 382652 ~ 382855 (-) True G59322
TU74144 lncRNA downstream 1096471 167758 ~ 168023 (-) True G59283
TU74266 lncRNA upstream 19691 1284425 ~ 1284745 (-) True G59390
TU74271 lncRNA upstream 82512 1347246 ~ 1347479 (-) True G59395
TU74272 lncRNA upstream 124611 1389345 ~ 1397225 (-) True G59396
TU74279 lncRNA upstream 228952 1493686 ~ 1493973 (-) True G59403
TU74290 lncRNA upstream 340368 1605102 ~ 1662179 (-) True G59414
AMCG00019883 mRNA downstream 318605 944898 ~ 945889 (-) True AMCG00019883
AMCG00019882 mRNA downstream 393598 869061 ~ 870896 (-) True AMCG00019882
AMCG00019881 mRNA downstream 671098 582350 ~ 593396 (-) True AMCG00019881
AMCG00019880 mRNA downstream 691667 535831 ~ 572827 (-) True AMCG00019880
AMCG00019878 mRNA downstream 782973 455460 ~ 481521 (-) True AMCG00019878
AMCG00019887 mRNA upstream 609826 1874560 ~ 1889869 (-) True AMCG00019887
AMCG00019888 mRNA upstream 648707 1913441 ~ 1920755 (-) True AMCG00019888
AMCG00019889 mRNA upstream 841096 2105830 ~ 2135939 (-) True AMCG00019889
AMCG00019890 mRNA upstream 895444 2160178 ~ 2185195 (-) True AMCG00019890
AMCG00019891 mRNA upstream 946943 2211677 ~ 2212773 (-) True AMCG00019891
TU74284 other upstream 320185 1584919 ~ 1586000 (-) True G59408
TU74395 other upstream 1059554 2324288 ~ 2327415 (-) True G59505
TU74434 other upstream 1190177 2454911 ~ 2480799 (-) True G59530
TU74449 other upstream 1230165 2494899 ~ 2507020 (-) True G59545
TU74667 other upstream 1767122 3031856 ~ 3034335 (-) True G59712

Expression Profile