RNA id: TU103179


Basic Information

Item Value
RNA id TU103179
length 532
RNA type TUCP
GC content 0.70
exon number 2
gene id G69757
representative True

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 12985124 ~ 12985978 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

gccggaggagaggaatcccgaggcgacggatggtcgacgacagaccaaggcggagccggagggacgatggagcctggtggagctggtggactgacggaccacggtgtagaggagggagctaggagcccagggggagccgacgggtctacgagccgaggaggagtctgggtctcggaggcaggacggcgaggcgagggatccttcaccctcgacggcgatggagaccggcagacccgtggcgagctccggatggtgagctgaggatgagcgcaggggctgctgggatccatcgacgtggtgtggcaagggtgggagggtgggaaaacttgaggcggcactggaggaagcgcacagggcgcgggcacaggaacgggacggagcgcacggggcgcgggcacaggaacgggacggagcgcacggggcgcgggcacaggaacgggacggagcgcacggggcgcgggcacaggaacgggacagagcgcacgtggcgcgggcactggaacgggacagagcgcacgtggcgcgggcactg

Function

GO:

id name namespace
GO:0090304 nucleic acid metabolic process biological_process
GO:0006974 cellular response to DNA damage stimulus biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0044237 cellular metabolic process biological_process
GO:0044238 primary metabolic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0033554 cellular response to stress biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0006259 DNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0006281 DNA repair biological_process

KEGG:

id description
ko03022 Basal transcription factors

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
XR_006251806.1 lncRNA downstream 195990 12787115 ~ 12789134 (-) True LOC122351847
TU103153 lncRNA downstream 211272 12773441 ~ 12773852 (-) True G69738
TU103148 lncRNA downstream 253381 12731041 ~ 12731743 (-) True G69733
TU103090 lncRNA downstream 338122 12645836 ~ 12647002 (-) True G69704
TU103059 lncRNA downstream 402699 12518286 ~ 12582425 (-) False lrch1
TU103184 lncRNA upstream 49978 13035956 ~ 13037453 (-) True G69762
XR_006251825.1 lncRNA upstream 242176 13228154 ~ 13232210 (-) True LOC122351987
TU103357 lncRNA upstream 244889 13230867 ~ 13232202 (-) False LOC122351987
TU103390 lncRNA upstream 316425 13302403 ~ 13327413 (-) True G69888
TU103400 lncRNA upstream 324895 13310873 ~ 13325669 (-) True G69896
XM_043248565.1 mRNA downstream 169986 12814153 ~ 12815138 (-) True LOC122351488
XM_043249565.1 mRNA downstream 256020 12723401 ~ 12729104 (-) True LOC122352069
XM_043248079.1 mRNA downstream 264434 12707976 ~ 12720690 (-) True LOC122351186
XM_043248931.1 mRNA downstream 344266 12619276 ~ 12640858 (-) False slc39a10
XM_043248427.1 mRNA upstream 128525 13114503 ~ 13118222 (-) False ftcdnl1
XM_043248426.1 mRNA upstream 128525 13114503 ~ 13118201 (-) False ftcdnl1
XM_043248425.1 mRNA upstream 128525 13114503 ~ 13117732 (-) True ftcdnl1
XM_043248428.1 mRNA upstream 128525 13114503 ~ 13117723 (-) False ftcdnl1
XM_043248954.1 mRNA upstream 144071 13130049 ~ 13137972 (-) True stk17b
XR_006251867.1 other downstream 246953 12738044 ~ 12738171 (-) True LOC122352189
TU103144 other downstream 273300 12708631 ~ 12711824 (-) False LOC122351186
TU102995 other downstream 561678 12422429 ~ 12423446 (-) True G69650
XR_006251743.1 other downstream 795468 12166991 ~ 12189656 (-) True gtdc1
TU102802 other downstream 1485752 11497010 ~ 11499372 (-) False LOC122351308
TU103524 other upstream 487162 13473140 ~ 13495645 (-) False gypc
TU103526 other upstream 487162 13473140 ~ 13495645 (-) False gypc
TU103924 other upstream 821844 13807822 ~ 13813327 (-) True G70261
TU103993 other upstream 952281 13938259 ~ 13939868 (-) True G70294
TU104031 other upstream 1210501 14196479 ~ 14253776 (-) True G70317

Expression Profile