RNA id: TU103479



Basic Information


Item Value
RNA id TU103479
length 372
lncRNA type inter_gene
GC content 0.60
exon number 2
gene id G69953
representative True

Chromosome Information


Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 13411812 ~ 13412439 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence


CGGCTTAAATGCGTGCTGACCTGTCTTGAGATACGCTGATAACCCCGTCCTCCTTGGGGATGATCACAGCCGTATTCACCACATCTTGAAAACCCTCGATCTTACTCAGCAGGACGGGTTTTCGGGTCTGCGGACGGGGATGGATCTCTGCCGCCATGGCGCTGTAGTTCCTCCGTCACCCGAGTCCTCTCTCGGCAGCATAACACGCCGAGCGCAGGTCGACTATCAGACCTGCAGTCGGTCAGGGATGCTGCGGGTCAGCTGATGAAGTCTCCCGGCCTGCGCTGGTCACGCTCAAACACGATCTCTATGCCATGGCCCCCGACGCCGCGCGCGCCGTCCTCTCGTTCTCCACGTACACGGACGATCCGA

Function


GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065009 regulation of molecular function biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010468 regulation of gene expression biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0051090 regulation of DNA-binding transcription factor activity biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU103390 lncRNA downstream 84399 13302403 ~ 13327413 (-) True G69888
TU103400 lncRNA downstream 86143 13310873 ~ 13325669 (-) True G69896
XR_006251825.1 lncRNA downstream 179602 13228154 ~ 13232210 (-) True LOC122351987
TU103357 lncRNA downstream 179610 13230867 ~ 13232202 (-) False LOC122351987
TU103184 lncRNA downstream 374359 13035956 ~ 13037453 (-) True G69762
TU103525 lncRNA upstream 60701 13473140 ~ 13495645 (-) False gypc
TU103573 lncRNA upstream 257364 13669803 ~ 13673807 (-) False tmem163a
TU103577 lncRNA upstream 262279 13674718 ~ 13675514 (-) True G70027
TU103589 lncRNA upstream 266941 13679380 ~ 13682139 (-) True G70033
TU103926 lncRNA upstream 403272 13815711 ~ 13816743 (-) True G70263
XM_043249085.1 mRNA downstream 1413 13400252 ~ 13410399 (-) True ints6
XM_043248869.1 mRNA downstream 48897 13354751 ~ 13362915 (-) True cops8
XM_043248870.1 mRNA downstream 48898 13358826 ~ 13362914 (-) False cops8
XM_043249431.1 mRNA downstream 160153 13236681 ~ 13251659 (-) True mlphb
XM_043249436.1 mRNA downstream 175628 13235407 ~ 13236184 (-) True prlh
XM_043248842.1 mRNA upstream 7576 13420015 ~ 13424845 (-) True dhrs12
XM_043248838.1 mRNA upstream 21526 13433965 ~ 13444172 (-) True parp14rs1
XM_043248171.1 mRNA upstream 37431 13449870 ~ 13454850 (-) False faima
XM_043248170.1 mRNA upstream 37431 13449870 ~ 13454698 (-) True faima
XM_043248890.1 mRNA upstream 60696 13473135 ~ 13495667 (-) True gypc
TU103179 other downstream 425834 12985124 ~ 12985978 (-) True G69757
XR_006251867.1 other downstream 673641 12738044 ~ 12738171 (-) True LOC122352189
TU103144 other downstream 699988 12708631 ~ 12711824 (-) False LOC122351186
TU102995 other downstream 988366 12422429 ~ 12423446 (-) True G69650
XR_006251743.1 other downstream 1222156 12166991 ~ 12189656 (-) True gtdc1
TU103524 other upstream 60701 13473140 ~ 13495645 (-) False gypc
TU103526 other upstream 60701 13473140 ~ 13495645 (-) False gypc
TU103924 other upstream 395383 13807822 ~ 13813327 (-) True G70261
TU103993 other upstream 525820 13938259 ~ 13939868 (-) True G70294
TU104031 other upstream 784040 14196479 ~ 14253776 (-) True G70317

Expression Profile