RNA id: XM_043249022.1


Basic Information

Item Value
RNA id XM_043249022.1
length 519
RNA type mRNA
GC content 0.53
exon number 3
gene id LOC122351750
representative True

Chromosome Information

Item Value
chromosome id NC_056707.1
NCBI id CM032076.1
chromosome length 26426558
location 23914681 ~ 23918652 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

ATGCCCAAATCCTTTAACCTACCCTTCCCTTCATCAGGAGAATTAAATGGCACGCGGTCCCCTCCAGTAAAAAAGCCTGGCAAAGAAAGCAACTACCAGCACATCAAGGAAATGGCCGTAAAGCAGCATCTCAGTAACAAGAGGACCAGGATGTACAGCCCCCAGGATGATCCCAAAACACCTCACCCCAGACAGAGCCAGTGTCAACAGGAGCTGGACAGAGTTTTGGAGAACATCTCCCGAATGACGTTCCATGACAACAAGGGACCTTTGGAAAATCTTTATGACCTGAAGTTCCCCAACTGTGACAAGACAGGACAGTACAACCTTAAACAGTGCAACATGTCCAGCCACGGACAGAGGGGCGAGTGTTGGTGCGTCAACCCCTACACTGGTGTCCAGATACCCTCGTCCCCCAAAGTGAGGGGGGACCCCAACTGCAGCCAGTACTACGGTGGTCCTGAGCTGGAACCGCCCACCAGCCAGCAGAAATAGACGTACCCTCGCCCTTAAGGGAGA

Function

GO:

id name namespace
GO:0043567 regulation of insulin-like growth factor receptor signaling pathway biological_process
GO:0008156 negative regulation of DNA replication biological_process
GO:0007275 multicellular organism development biological_process
GO:0001558 regulation of cell growth biological_process
GO:0008285 negative regulation of cell population proliferation biological_process
GO:0048640 negative regulation of developmental growth biological_process
GO:0005576 extracellular region cellular_component
GO:0031994 insulin-like growth factor I binding molecular_function
GO:0031995 insulin-like growth factor II binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU107919 lncRNA downstream 795 23912173 ~ 23913886 (-) True G72927
TU107908 lncRNA downstream 2645 23911453 ~ 23912036 (-) True G72923
TU107903 lncRNA downstream 280604 23558753 ~ 23634077 (-) True G72918
TU107885 lncRNA downstream 313789 23598987 ~ 23600892 (-) True G72904
TU107891 lncRNA downstream 374578 23537504 ~ 23540103 (-) True G72909
TU107925 lncRNA upstream 7571 23926223 ~ 23981238 (-) False G72929
TU107928 lncRNA upstream 7571 23926223 ~ 23981238 (-) True G72929
TU108005 lncRNA upstream 334710 24253362 ~ 24285690 (-) True G72980
TU108009 lncRNA upstream 363339 24281991 ~ 24284165 (-) True G72984
TU108125 lncRNA upstream 594442 24513094 ~ 24521308 (-) True G73077
XM_043249021.1 mRNA downstream 197626 23716109 ~ 23717055 (-) True LOC122351749
XM_043249556.1 mRNA downstream 265121 23564379 ~ 23649560 (-) True LOC122352061
XM_043249534.1 mRNA downstream 488247 23419262 ~ 23426434 (-) True gjc4b
XM_043249535.1 mRNA downstream 488681 23419262 ~ 23426000 (-) False gjc4b
XM_043249020.1 mRNA downstream 503691 23390692 ~ 23410990 (-) True LOC122351748
XM_043248342.1 mRNA upstream 25333 23943985 ~ 23960093 (-) True grb14
XM_043248989.1 mRNA upstream 63318 23981970 ~ 24029114 (-) False cobll1b
XM_043248987.1 mRNA upstream 63319 23981971 ~ 24029114 (-) True cobll1b
XM_043248988.1 mRNA upstream 63320 23981972 ~ 24029114 (-) False cobll1b
XM_043248991.1 mRNA upstream 63320 23981972 ~ 24010861 (-) False cobll1b
TU107329 other downstream 1403374 22459396 ~ 22511307 (-) False LOC122351746
TU107316 other downstream 1607668 22299172 ~ 22307013 (-) False LOC122351746
XR_006251764.1 other downstream 1691014 22171463 ~ 22223667 (-) False cerkl
TU107092 other downstream 2187861 21709288 ~ 21726820 (-) True G72363
TU106615 other downstream 3410791 20489164 ~ 20503890 (-) True G71938
TU107929 other upstream 11555 23930207 ~ 23931329 (-) True G72930
TU107931 other upstream 37567 23956219 ~ 23960325 (-) False grb14
TU108001 other upstream 301870 24220522 ~ 24280708 (-) False G72978
TU108002 other upstream 312583 24231235 ~ 24280708 (-) False G72978
TU108000 other upstream 352803 24271455 ~ 24280708 (-) True G72978

Expression Profile