RNA id: TU9691


Basic Information

Item Value
RNA id TU9691
length 418
lncRNA type inter_gene
GC content 0.51
exon number 2
gene id G6636
representative True

Chromosome Information

Item Value
chromosome id NC_056699.1
NCBI id CM032068.1
chromosome length 31761587
location 25838851 ~ 25846530 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

GGAACGTTTGATCTGAAGCGTGATGAGGGAGCACACGTAACACGAGCTCAACGGACCTTCACCTCTCTGATGAAGTCCGACCAGTCCTTGTTCTGAATGATCCTAACCAGGCCTTGACTGATCCGGAAGGTGGCGTCCTCGTCGAAGCGGCCCTGACCTAAATGATGCGTCACGTAAACCCTGTCAAACCACGTGTCGCACCAGTCTGAATCGACCAAACAACGACGCGGGTCTGCGCTTGCTCTCACGTACATCAGGGTTGTAATTCTTGGTAACATTATTAGGCATCGCTCCGGGTCGGTGCAGGTTACCGATTTCATAATACTGCAGGTCAGTATCAGGAAGAATTCCTTCTGAGTTATGGAACGGATGGAAACCAAAATCTCGGTGTTCTGGGTCGCACAGTGCGATCATATTG

Function

GO:

id name namespace
GO:0002253 activation of immune response biological_process
GO:0006955 immune response biological_process
GO:0048584 positive regulation of response to stimulus biological_process
GO:0002376 immune system process biological_process
GO:0002682 regulation of immune system process biological_process
GO:0002684 positive regulation of immune system process biological_process
GO:0050776 regulation of immune response biological_process
GO:0050778 positive regulation of immune response biological_process
GO:0002218 activation of innate immune response biological_process
GO:0002221 pattern recognition receptor signaling pathway biological_process
GO:0002224 toll-like receptor signaling pathway biological_process
GO:0002757 immune response-activating signal transduction biological_process
GO:0002758 innate immune response-activating signal transduction biological_process
GO:0002764 immune response-regulating signaling pathway biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05144 Malaria

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU9628 lncRNA downstream 39578 25768907 ~ 25799273 (-) True G6594
TU9062 lncRNA downstream 101539 25736797 ~ 25737312 (-) True G6223
TU9030 lncRNA downstream 217106 25621434 ~ 25621745 (-) True G6201
TU9029 lncRNA downstream 218347 25620246 ~ 25620504 (-) True G6200
TU8988 lncRNA downstream 333997 25503940 ~ 25504854 (-) True G6165
TU9693 lncRNA upstream 11045 25857575 ~ 25858204 (-) False patl1
TU9713 lncRNA upstream 72040 25918570 ~ 25918785 (-) True G6650
TU9715 lncRNA upstream 91891 25938421 ~ 25938851 (-) True G6652
TU9757 lncRNA upstream 218029 26064559 ~ 26066186 (-) True G6687
TU9739 lncRNA upstream 245479 26092009 ~ 26096257 (-) True G6670
XM_043251139.1 mRNA downstream 25002 25809879 ~ 25813849 (-) True aptx
XM_043251149.1 mRNA downstream 25286 25809879 ~ 25813565 (-) False aptx
XM_043251183.1 mRNA downstream 111313 25716158 ~ 25727538 (-) True LOC122353214
XM_043251160.1 mRNA downstream 123147 25714930 ~ 25715704 (-) False LOC122353196
XM_043251204.1 mRNA downstream 124877 25706824 ~ 25713974 (-) True LOC122353232
XM_043245059.1 mRNA upstream 11108 25857638 ~ 25863787 (-) True patl1
XM_043237101.1 mRNA upstream 222646 26069176 ~ 26076862 (-) True il15
XM_043237109.1 mRNA upstream 222646 26069176 ~ 26076861 (-) False il15
XM_043237118.1 mRNA upstream 222646 26069176 ~ 26076857 (-) False il15
XM_043237092.1 mRNA upstream 222646 26069176 ~ 26076856 (-) False il15
TU9035 other downstream 123173 25714102 ~ 25715678 (-) True LOC122353196
TU9033 other downstream 123173 25714668 ~ 25715678 (-) False LOC122353196
TU9017 other downstream 283616 25551749 ~ 25555235 (-) False prokr1a
TU8940 other downstream 436496 25401314 ~ 25402355 (-) False G6135
TU8935 other downstream 438834 25398491 ~ 25400017 (-) False G6134
TU9696 other upstream 13343 25859873 ~ 25860408 (-) False patl1
TU9622 other upstream 284258 26130788 ~ 26135486 (-) False G6592
TU9833 other upstream 570329 26416859 ~ 26417879 (-) False smdt1b
TU9834 other upstream 570353 26416883 ~ 26417879 (-) False smdt1b
TU10045 other upstream 955380 26801910 ~ 26802925 (-) True c1h19orf53

Expression Profile