RNA id: TU114879



Basic Information


Item Value
RNA id TU114879
length 401
lncRNA type inter_gene
GC content 0.55
exon number 1
gene id G77672
representative True

Chromosome Information


Item Value
chromosome id NC_056708.1
NCBI id CM032077.1
chromosome length 16503406
location 15138607 ~ 15139007 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence


gtgtggaaccggtattctcctgtgttctcacctcaaacgggtagaagcactgagaggcccggtttcgggtcggcttgttaaccgctccagagcgtccatacagtagaccctgtcgagctcctccattcccctcggcagccagatgttgcggagcatctggcgccaggccctctcgatgaatccgtgagaaccggtgagggctgggagccatgtaaagtaccccaagaggactttatgtgtgtatttccacggcatagccttagagccccgtgtttccccggcagaccttctgcccatctaagagggttcaatcacctccaattttccatatgcaaactgaaatactgtccatatgcgtattcgttccgagacctcctacgggaaggctggacttccgcacg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU114876 lncRNA downstream 35038 15102149 ~ 15103569 (-) True G77669
TU114743 lncRNA downstream 548727 14588406 ~ 14589880 (-) False vwa3a
TU114679 lncRNA downstream 641153 14495498 ~ 14497454 (-) True G77514
XR_006251945.1 lncRNA downstream 673287 14460368 ~ 14465320 (-) True LOC122353010
TU114626 lncRNA downstream 713120 14424513 ~ 14425487 (-) True G77480
TU114881 lncRNA upstream 17342 15156349 ~ 15156591 (-) True G77674
TU114883 lncRNA upstream 20458 15159465 ~ 15159847 (-) True G77676
TU114900 lncRNA upstream 134906 15273913 ~ 15276004 (-) True G77692
TU114908 lncRNA upstream 205993 15345000 ~ 15347289 (-) True G77700
TU114911 lncRNA upstream 229394 15368401 ~ 15368676 (-) True G77703
XM_043249857.1 mRNA downstream 23159 15111412 ~ 15115448 (-) True LOC122352450
XM_043250046.1 mRNA downstream 509533 14620986 ~ 14629074 (-) True si:ch211-256e16.3
XM_043250047.1 mRNA downstream 519997 14611801 ~ 14618610 (-) True LOC122352591
XM_043250050.1 mRNA downstream 527384 14591019 ~ 14611223 (-) True mosmoa
XM_043250015.1 mRNA downstream 548712 14568330 ~ 14589895 (-) False vwa3a
XM_043250334.1 mRNA upstream 94134 15233141 ~ 15289672 (-) False LOC122352744
XM_043250333.1 mRNA upstream 94134 15233141 ~ 15289672 (-) True LOC122352744
XM_043249858.1 mRNA upstream 166528 15305535 ~ 15306408 (-) True LOC122352451
XM_043250086.1 mRNA upstream 168892 15307899 ~ 15314674 (-) False LOC122352614
XM_043250085.1 mRNA upstream 168895 15307902 ~ 15315868 (-) True LOC122352614
TU114878 other downstream 30855 15107137 ~ 15107752 (-) True G77671
XR_006251888.1 other downstream 548708 14569361 ~ 14589899 (-) False vwa3a
TU114673 other downstream 653337 14484817 ~ 14485270 (-) False im:6904045
XR_006251944.1 other downstream 657158 14467186 ~ 14481449 (-) False LOC122353009
TU114670 other downstream 657170 14474120 ~ 14481437 (-) True LOC122353009
XR_006251922.1 other upstream 90962 15229969 ~ 15289672 (-) False LOC122352744
TU114910 other upstream 218678 15357685 ~ 15358232 (-) True G77702
TU115089 other upstream 754676 15893683 ~ 15897098 (-) False npffr1l1
TU115119 other upstream 877664 16016671 ~ 16017770 (-) False LOC122352931
XR_006251960.1 other upstream 891520 16030527 ~ 16057307 (-) False cabp1b

Expression Profile


TU114879 Expression in all Baseline Samples

Bar chart with 10 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 14.
End of interactive chart.

TU114879 Expression in each Bioproject

Bar chart with 2 bars.
TU114879 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.