RNA id: TU14739


Basic Information

Item Value
RNA id TU14739
length 270
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G9892
representative True

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 6755823 ~ 6756092 (+)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

ccggggagcagggcaatcgggggaaatgcgtacaggcgacgccttggccacgcctgtgacatggcatccagtcccaggggagctggatgaactagagagaaccagaggggacattgtgcattccctcgagaagcaaagaggtccacctctgcctggtaaaatctcgaccagatctgcttcaccacgtcggggtgaagcatccattcccccggcctcaacccctgtctcgacagggtgtcggctcccgtattgagatgcccagggatgtag

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0051090 regulation of DNA-binding transcription factor activity biological_process

KEGG:

id description
ko04350 TGF-beta signaling pathway

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU14737 lncRNA upstream 13650 6741733 ~ 6742173 (+) True G9890
TU14731 lncRNA upstream 106023 6649446 ~ 6649800 (+) True G9884
XR_006252542.1 lncRNA upstream 200893 6539289 ~ 6554930 (+) True LOC122357847
TU14689 lncRNA upstream 204472 6546230 ~ 6551351 (+) True G9847
TU14680 lncRNA upstream 228191 6527369 ~ 6527632 (+) True G9840
TU14740 lncRNA downstream 72355 6828447 ~ 6829096 (+) True G9893
TU14749 lncRNA downstream 86059 6842151 ~ 6842425 (+) True G9901
TU14775 lncRNA downstream 169877 6925969 ~ 6926177 (+) True G9918
TU14790 lncRNA downstream 244968 7001060 ~ 7001479 (+) True G9928
TU14792 lncRNA downstream 253268 7009360 ~ 7010594 (+) True G9930
XM_043218864.1 mRNA upstream 267123 6474022 ~ 6488700 (+) False slc35d1b
XM_043218854.1 mRNA upstream 267123 6474023 ~ 6488700 (+) False slc35d1b
XM_043218872.1 mRNA upstream 267123 6474109 ~ 6488700 (+) True slc35d1b
XM_043219129.1 mRNA upstream 387869 6367192 ~ 6367954 (+) False sst2
XM_043217056.1 mRNA upstream 418251 6285922 ~ 6337572 (+) False fgf12a
XM_043262122.1 mRNA downstream 84534 6840626 ~ 6842093 (+) True LOC122361319
XM_043260277.1 mRNA downstream 100152 6856244 ~ 6879649 (+) True bpnt2
XM_043260303.1 mRNA downstream 100159 6856251 ~ 6878523 (+) False bpnt2
XM_043260288.1 mRNA downstream 100162 6856254 ~ 6879649 (+) False bpnt2
XM_043260312.1 mRNA downstream 100171 6856263 ~ 6878523 (+) False bpnt2
TU14736 other upstream 63448 6691668 ~ 6692375 (+) True G9889
TU14734 other upstream 65044 6690372 ~ 6690779 (+) True G9887
TU14569 other upstream 387869 6367177 ~ 6367954 (+) True sst2
unassigned_transcript_205 other upstream 533304 6222445 ~ 6222519 (+) True trnag-gcc_21
unassigned_transcript_204 other upstream 535323 6220426 ~ 6220500 (+) True trnag-gcc_20
TU14783 other downstream 230206 6986298 ~ 6987119 (+) True G9925
TU15034 other downstream 749499 7505591 ~ 7582385 (+) False G10108
TU15202 other downstream 1350773 8106865 ~ 8107777 (+) True G10212
XR_006252402.1 other downstream 2406519 9162611 ~ 9171915 (+) False olfm3b
TU15832 other downstream 2990502 9746594 ~ 9751212 (+) True arpc5a

Expression Profile