RNA id: TCONS_00014115


Basic Information

Item Value
RNA id TCONS_00014115
length 515
RNA type processed_transcript
GC content 0.46
exon number 4
gene id XLOC_007137
representative True

Chromosome Information

Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 9287683 ~ 9336601 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCGGGCTCATCATTTGAATTAAATAACGGACACAAGCAACGGGCGGAACGGTAATCAAAGATAAACGTTCGGGTCACTACAATGGATGCTGAGCTGGAGTTTGCCATTCAGTCCAGTACAACTGGTAAACAACTTTTTGACCAAGTTGTGAAAACAATTGGACTCCGAGAGATCTGGTACTTCGGACTGCAGTATCAGGACAGCAAGGGCTTCTCTACATGGCTGAAACTCAATAAGCGGGTGACTGCTCAAGACGTCAGAAAAGAAAATCCACTGCTGATTAAATTCAGAGCAAAGTTCTACCCTGAGGATGTGGCAGAAGAGCTGATTCAGGAAGCCACACAGCGCTTGTTTTTCCTCCAGGTGAAAGAAGCCATTTTGAATGATGACATCTACTGTCCACCTGAGACGGCGGTTCTGCTGGCTTCATATGCTGTGCAGATGAAGCACAGTGACTATAATAGTGAACATCACATTCCTGGATATTTGTGCAGAGACAAACTGCTGCCACAAAG

Function

GO:

id name namespace
GO:0005856 cytoskeleton cellular_component
GO:0003779 actin binding molecular_function
GO:0008092 cytoskeletal protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030717-7 Predicted to enable actin binding activity. Predicted to be located in cytoplasm; cytoskeleton; and plasma membrane. Human ortholog(s) of this gene implicated in immunodeficiency 50. Orthologous to human MSN (moesin).

Ensembl:

ensembl_id ENSDART00000144400

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00016133 lncRNA upstream 233773 9059204 ~ 9066756 (+) False XLOC_007135
TCONS_00015953 lncRNA upstream 233915 9060146 ~ 9066614 (+) True XLOC_007135
TCONS_00014109 lncRNA upstream 298125 8997541 ~ 9002404 (+) True XLOC_007133
TCONS_00014108 lncRNA upstream 337126 8947559 ~ 8963403 (+) False XLOC_007133
TCONS_00014100 lncRNA upstream 733022 8542170 ~ 8567507 (+) True XLOC_007128
TCONS_00014117 lncRNA downstream 108140 9422429 ~ 9427939 (+) True XLOC_007138
TCONS_00014123 lncRNA downstream 170778 9485067 ~ 9499220 (+) False XLOC_007141
TCONS_00016134 lncRNA downstream 256529 9570818 ~ 9578082 (+) True XLOC_007143
TCONS_00016135 lncRNA downstream 1176509 10490798 ~ 10492241 (+) True XLOC_007147
TCONS_00014140 lncRNA downstream 1413846 10728135 ~ 10731150 (+) True XLOC_007151
TCONS_00014113 mRNA upstream 5619 9246361 ~ 9294910 (+) True XLOC_007136
TCONS_00014110 mRNA upstream 271574 9009600 ~ 9028955 (+) True XLOC_007134
TCONS_00014107 mRNA upstream 298124 8947282 ~ 9002405 (+) False XLOC_007133
TCONS_00014106 mRNA upstream 329393 8940326 ~ 8971136 (+) False XLOC_007133
TCONS_00014104 mRNA upstream 553356 8715527 ~ 8747173 (+) True XLOC_007131
TCONS_00014116 mRNA downstream 107221 9421510 ~ 9428248 (+) False XLOC_007138
TCONS_00014118 mRNA downstream 118338 9432627 ~ 9447115 (+) True XLOC_007139
TCONS_00014119 mRNA downstream 142386 9456675 ~ 9469634 (+) False XLOC_007140
TCONS_00014120 mRNA downstream 148437 9462726 ~ 9475845 (+) True XLOC_007140
TCONS_00014121 mRNA downstream 167154 9481443 ~ 9485352 (+) False XLOC_007141
TCONS_00014111 other upstream 233773 9056071 ~ 9066756 (+) False XLOC_007135
TCONS_00014112 other upstream 238942 9059204 ~ 9061587 (+) False XLOC_007135
TCONS_00014092 other upstream 869254 8343494 ~ 8431275 (+) False XLOC_007124
TCONS_00014038 other upstream 3193374 6107039 ~ 6107155 (+) True XLOC_007093
TCONS_00014031 other upstream 3447864 5835158 ~ 5852665 (+) False XLOC_007088
TCONS_00014141 other downstream 1502008 10816297 ~ 10816413 (+) True XLOC_007153
TCONS_00014154 other downstream 2143240 11457529 ~ 11459056 (+) False XLOC_007162
TCONS_00014158 other downstream 2614254 11928543 ~ 11929156 (+) False XLOC_007163
TCONS_00014169 other downstream 2875548 12189837 ~ 12203193 (+) True XLOC_007167
TCONS_00014206 other downstream 5522784 14837073 ~ 14837270 (+) True XLOC_007188

Expression Profile

//