RNA id: TCONS_00014206


Basic Information

Item Value
RNA id TCONS_00014206
length 198
RNA type snoRNA
GC content 0.53
exon number 1
gene id XLOC_007188
representative True

Chromosome Information

Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 14835312 ~ 14841159 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCCAGCGGTAGTCAGCTGTGCAGGCCAGACCATGCCTGAGCTAGTGTTACTCTGCTGGAAGAGAAAGGCACTGCCATTTGTGCTCCATCAGGTTTGGCTGTTTTAGTGAATCCTGCTGTGTGGTGCTGGTTATGCCATGTCTTCTGAGAGTGGCCTGTACTCACAAAATGAGGCAGGCCTAGTCTGGAGGCAAACACT

Function

GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0000027 ribosomal large subunit assembly biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0065003 protein-containing complex assembly biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0006396 RNA processing biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042255 ribosome assembly biological_process
GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0030684 preribosome cellular_component
GO:0030687 preribosome, large subunit precursor cellular_component
GO:0030688 preribosome, small subunit precursor cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0005634 nucleus cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0030515 snoRNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000171449

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00014199 lncRNA upstream 14388 14818937 ~ 14822685 (+) True XLOC_007187
TCONS_00016149 lncRNA upstream 31051 14785490 ~ 14806022 (+) True XLOC_007186
TCONS_00016147 lncRNA upstream 96264 14698334 ~ 14740809 (+) True XLOC_007184
TCONS_00016148 lncRNA upstream 111587 14722024 ~ 14725486 (+) True XLOC_007185
TCONS_00015960 lncRNA upstream 639591 14190005 ~ 14197482 (+) True XLOC_007178
TCONS_00016173 lncRNA downstream 29309 14866579 ~ 14886131 (+) False XLOC_007191
TCONS_00016172 lncRNA downstream 29309 14866579 ~ 14886131 (+) False XLOC_007191
TCONS_00016174 lncRNA downstream 29491 14866761 ~ 14886131 (+) True XLOC_007191
TCONS_00016175 lncRNA downstream 155307 14992577 ~ 14994921 (+) False XLOC_007193
TCONS_00016176 lncRNA downstream 317313 15154583 ~ 15155416 (+) True XLOC_007195
TCONS_00014198 mRNA upstream 8587 14806851 ~ 14828486 (+) False XLOC_007187
TCONS_00014197 mRNA upstream 21947 14806692 ~ 14815126 (+) False XLOC_007187
TCONS_00014196 mRNA upstream 170517 14662116 ~ 14666556 (+) True XLOC_007183
TCONS_00014195 mRNA upstream 214089 14608099 ~ 14622984 (+) True XLOC_007182
TCONS_00014194 mRNA upstream 240374 14577246 ~ 14596699 (+) True XLOC_007181
TCONS_00014207 mRNA downstream 4415 14841685 ~ 14846166 (+) False XLOC_007189
TCONS_00014208 mRNA downstream 4459 14841729 ~ 14845969 (+) False XLOC_007189
TCONS_00014210 mRNA downstream 10034 14847304 ~ 14865048 (+) False XLOC_007190
TCONS_00014212 mRNA downstream 10475 14847745 ~ 14865340 (+) False XLOC_007190
TCONS_00014211 mRNA downstream 10475 14847745 ~ 14865340 (+) True XLOC_007190
TCONS_00014169 other upstream 2633880 12189837 ~ 12203193 (+) True XLOC_007167
TCONS_00014158 other upstream 2907917 11928543 ~ 11929156 (+) False XLOC_007163
TCONS_00014154 other upstream 3378017 11457529 ~ 11459056 (+) False XLOC_007162
TCONS_00014141 other upstream 4020660 10816297 ~ 10816413 (+) True XLOC_007153
TCONS_00014115 other upstream 5522784 9300529 ~ 9314289 (+) True XLOC_007137
TCONS_00014209 other downstream 7646 14844916 ~ 14846159 (+) True XLOC_007189
TCONS_00014213 other downstream 72283 14909553 ~ 14909670 (+) True XLOC_007192
TCONS_00014275 other downstream 3962164 18799434 ~ 18799558 (+) True XLOC_007232
TCONS_00014313 other downstream 6401412 21238682 ~ 21245773 (+) False XLOC_007253
TCONS_00014315 other downstream 6833837 21671107 ~ 21678917 (+) False XLOC_007255

Expression Profile

//