RNA id: TCONS_00014394


Basic Information

Item Value
RNA id TCONS_00014394
length 511
lncRNA type retained_intron
GC content 0.53
exon number 2
gene id XLOC_007292
representative False

Chromosome Information

Item Value
chromosome id NC_007125.7
NCBI id CM002898.2
chromosome length 52660232
location 24215046 ~ 24221965 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTCGATCAGTCTCCGCATCAGATCTCAGGCTGACAGCCTGTGTCATTATAGCTCGAGAAATTGAGAGTCGAAATGCTGATTAAATTCACACTGTCCCTGCTGCTGCTCTCCGTATTGGGGGAAGTGGTAGGAACGGATAATCCTGATGTGCACGAGAGTCACCCCGAGAAACCGGCCAGTCAGAAGGGACGTCTCTCGTTACAGAACACAGCTGAGATCCAGCACTGTCTTGTGAGTGCAGGAGATGTGGGCTGCGGGGTGTTTGAGTGTTTCGAAAACAACTCGTGTGAAATTCGGGGCCTCCAGGAAATCTGCATGACCTTCTTGCACAATGCTGGCAAGTTCGACTCGCAGGTAAATTCATGGCTGCCCCAGTCTCATATGGGGTTCATGTCCCATCCAGAGGATGACCCTGCTGCTGGCTCAGCCAGCTGGCACTGCCTCCAGCAGGGCTCATGTTTCACAAGGTGCAGGTGGATTTGAGGCTGTGGGTTTCAGGCTTGTAATGCAG

Function

GO:

id name namespace
GO:0044092 negative regulation of molecular function biological_process
GO:0006874 cellular calcium ion homeostasis biological_process
GO:0043005 neuron projection cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0061134 peptidase regulator activity molecular_function
GO:0030414 peptidase inhibitor activity molecular_function
GO:0004857 enzyme inhibitor activity molecular_function
GO:0005179 hormone activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041008-14 Predicted to enable hormone activity. Predicted to be involved in cellular calcium ion homeostasis. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including cleithrum; nervous system; neural tube; presumptive telencephalon; and pronephros. Orthologous to human STC2 (stanniocalcin 2).

Ensembl:

ensembl_id ENSDART00000138082

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00014388 lncRNA upstream 250905 23960728 ~ 23964141 (+) True XLOC_007287
TCONS_00014383 lncRNA upstream 504458 23709642 ~ 23710588 (+) True XLOC_007284
TCONS_00014368 lncRNA upstream 842330 23076128 ~ 23372716 (+) False XLOC_007280
TCONS_00015972 lncRNA upstream 1255826 22957867 ~ 22959220 (+) True XLOC_007279
TCONS_00016204 lncRNA upstream 1255834 22841348 ~ 22959212 (+) False XLOC_007279
TCONS_00016205 lncRNA downstream 13123 24230911 ~ 24234703 (+) True XLOC_007293
TCONS_00015973 lncRNA downstream 59808 24277596 ~ 24280411 (+) False XLOC_007296
TCONS_00014400 lncRNA downstream 60259 24278047 ~ 24283714 (+) False XLOC_007296
TCONS_00014401 lncRNA downstream 62432 24280220 ~ 24283708 (+) False XLOC_007296
TCONS_00014402 lncRNA downstream 62598 24280386 ~ 24283719 (+) True XLOC_007296
TCONS_00014393 mRNA upstream 104566 24075254 ~ 24110480 (+) True XLOC_007291
TCONS_00014392 mRNA upstream 171195 24042760 ~ 24043851 (+) True XLOC_007290
TCONS_00014391 mRNA upstream 180348 24033718 ~ 24034698 (+) True XLOC_007289
TCONS_00014389 mRNA upstream 215480 23970818 ~ 23999566 (+) False XLOC_007288
TCONS_00014390 mRNA upstream 236522 23970832 ~ 23978524 (+) True XLOC_007288
TCONS_00014396 mRNA downstream 23453 24241241 ~ 24244034 (+) True XLOC_007294
TCONS_00014397 mRNA downstream 40774 24258562 ~ 24262791 (+) False XLOC_007295
TCONS_00014398 mRNA downstream 40774 24258562 ~ 24262815 (+) True XLOC_007295
TCONS_00014399 mRNA downstream 59768 24277556 ~ 24279957 (+) False XLOC_007296
TCONS_00014403 mRNA downstream 66127 24283915 ~ 24304936 (+) False XLOC_007297
TCONS_00014372 other upstream 842574 23187112 ~ 23372472 (+) True XLOC_007280
TCONS_00014367 other upstream 1059390 23076127 ~ 23155656 (+) False XLOC_007280
TCONS_00014351 other upstream 1896045 22316234 ~ 22319001 (+) False XLOC_007271
TCONS_00014324 other upstream 2469562 21739616 ~ 21745484 (+) True XLOC_007257
TCONS_00014315 other upstream 2536129 21671107 ~ 21678917 (+) False XLOC_007255
TCONS_00014405 other downstream 139612 24357400 ~ 24357517 (+) True XLOC_007298
TCONS_00014442 other downstream 2579116 26796904 ~ 26830566 (+) False XLOC_007327
TCONS_00014490 other downstream 6195989 30413777 ~ 30424854 (+) False XLOC_007352
TCONS_00014495 other downstream 6370179 30587967 ~ 30620257 (+) False XLOC_007356
TCONS_00014499 other downstream 6523200 30740988 ~ 30741116 (+) True XLOC_007359

Expression Profile

//