Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU345429

Basic Information

Item	Value
RNA id	TU345429
length	229
lncRNA type	intronic
GC content	0.58
exon number	1
gene id	G304021
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000092
NCBI id	null
chromosome length	5370156
location	17188 ~ 17416 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

GCACGATGTCGCCAGCTCACGCACCTGGTCAGAGTCTAGCAGTGGTCCAGGCTCTGGGGTGATGACTCCTTCCGAGCTCTTCTCTGATTCGGGCTCGTCTATCATGGCAGGCCGGTCTCCACGGTCTGCGGTGGGCAAAGGAAACTCCATCGTACCAGTCGCAGTCAGTGGTAGATGGCTGGTTTCTGTGGAACTGTGGAACTGGTAATGCTGTCATCTTCAGCAGGGC

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU345428	lncRNA	downstream	50	16924 ~ 17138 (-)	True	G304020
TU345427	lncRNA	downstream	296	16666 ~ 16892 (-)	True	G304019
TU345430	lncRNA	upstream	1006	18422 ~ 18624 (-)	True	G304022
TU345433	lncRNA	upstream	4743	22159 ~ 22448 (-)	True	G304025
TU345409	lncRNA	upstream	62097	79513 ~ 86265 (-)	False	G304004
TU345410	lncRNA	upstream	62109	79525 ~ 86265 (-)	True	G304004
TU345420	lncRNA	upstream	74219	91635 ~ 93404 (-)	True	G304012
CI01000092_00103480_00114306.mRNA	mRNA	upstream	84752	102168 ~ 114742 (-)	True	CI01000092_00103480_00114306
CI01000092_00116452_00128007.mRNA	mRNA	upstream	97919	115335 ~ 128007 (-)	True	CI01000092_00116452_00128007
CI01000092_00156990_00162891.mRNA	mRNA	upstream	139574	156990 ~ 162891 (-)	True	CI01000092_00156990_00162891
CI01000092_00174874_00180333.mRNA	mRNA	upstream	157458	174874 ~ 180333 (-)	True	CI01000092_00174874_00180333
CI01000092_00237358_00269420.mRNA	mRNA	upstream	218896	236312 ~ 271283 (-)	True	CI01000092_00237358_00269420
TU345836	other	upstream	1037888	1055304 ~ 1055722 (-)	True	G304368
TU345843	other	upstream	1040909	1058325 ~ 1058864 (-)	False	G304369
TU345840	other	upstream	1040951	1058367 ~ 1058920 (-)	False	G304369
TU345842	other	upstream	1040951	1058367 ~ 1058864 (-)	True	G304369
TU345834	other	upstream	1069246	1086662 ~ 1096918 (-)	True	CI01000092_01086701_01097333

Expression Profile