Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU349429

Basic Information

Item	Value
RNA id	TU349429
length	240
lncRNA type	inter_gene
GC content	0.35
exon number	1
gene id	G307521
representative	True

Chromosome Information

Item	Value
chromosome id	CI01000093
NCBI id	null
chromosome length	1475560
location	189305 ~ 189544 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome
species	grasscarp (Ctenopharyngodon idella)

Sequence

CACCCGTAAGACCTTCGTTCATCTTTGGAACACAAATTAAGATATTTTTGATGAAATCCGATGGCTCAGTGAGGCCTACATAGCCAGCAATGACATTTCCTCTCTCAAGATCCATTAATGTACTAAAAACATATTTAAATCAGTTCATGTGAGTACAGTGGTTCAATATTAATATTATAAAGCCACGAGAATATTTTTGGTGCGGCAAAAAAACAAAAAAAACGACTTATATAGTGATGG

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU349427	lncRNA	downstream	3357	185714 ~ 185948 (-)	True	G307519
TU349426	lncRNA	downstream	3734	185274 ~ 185571 (-)	True	G307518
TU349404	lncRNA	downstream	32916	146434 ~ 156389 (-)	False	G307499
TU349400	lncRNA	downstream	32958	149578 ~ 156347 (-)	True	G307499
TU349389	lncRNA	downstream	48874	140102 ~ 140431 (-)	True	G307494
TU349430	lncRNA	upstream	1554	191098 ~ 191926 (-)	True	G307522
TU349550	lncRNA	upstream	125729	315273 ~ 339260 (-)	True	G307622
TU349577	lncRNA	upstream	158154	347698 ~ 347953 (-)	True	G307648
TU349588	lncRNA	upstream	174085	363629 ~ 364071 (-)	True	G307659
TU349544	lncRNA	upstream	186364	375908 ~ 376290 (-)	True	G307617
CI01000093_00044285_00045637.mRNA	mRNA	downstream	143653	44016 ~ 45652 (-)	False	CI01000093_00044285_00045637
CI01000093_00021721_00029528.mRNA	mRNA	downstream	159777	21721 ~ 29528 (-)	True	CI01000093_00021721_00029528
CI01000093_00000644_00001222.mRNA	mRNA	downstream	188083	469 ~ 1222 (-)	True	CI01000093_00000644_00001222
CI01000093_00224221_00233968.mRNA	mRNA	upstream	34321	223865 ~ 236442 (-)	True	CI01000093_00224221_00233968
CI01000093_00372074_00372877.mRNA	mRNA	upstream	182251	371795 ~ 373025 (-)	True	CI01000093_00372074_00372877
CI01000093_00441786_00443029.mRNA	mRNA	upstream	251824	441368 ~ 443590 (-)	True	CI01000093_00441786_00443029
CI01000093_00601248_00607534.mRNA	mRNA	upstream	411541	601085 ~ 607729 (-)	True	CI01000093_00601248_00607534
CI01000093_00633602_00642455.mRNA	mRNA	upstream	442082	631626 ~ 642522 (-)	True	CI01000093_00633602_00642455
TU349703	other	upstream	878475	1073022 ~ 1073753 (-)	True	G307751

Expression Profile