RNA id: TCONS_00017632


Basic Information

Item Value
RNA id TCONS_00017632
length 529
RNA type mRNA
GC content 0.50
exon number 7
gene id XLOC_008924
representative False

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 1897375 ~ 2010926 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAACCAGAAGTCTGCTCATGTGTTTCCTGCACATTATGAAGACCATCTCAGAGGAGGTGATGGTTTCATACTGGCATCGAGCGATTCACCAGGAGATCAGTGACTTCTTCAATATTTTGGAATTATGCCTTCAGCACTTTCGTTTCCTTGGAAAGCGGCACATTGCCAGGAAGCTAGCGGCCGCAGTTAAGCTGGCTCAGGCCACACAGAACAATGGCACCCTGAAGGGCTCTAATGTGTCCTACCACTCTCCAGGGCTCCTACCCCAATGGATTCTGTCTGCACAGGACGGTCACAGACACGCTCGCTCTCAGACCATGCCCATCATCAGGGGGAAAAACGCCCTCACAAACCCCAAACTGCTGCATATGATGGAGACAGACGTGGAGGCGAACCTTTCTACTGAAGTAGCACTGACCGTGTTGGATGTTCTGGACCTGTTTGTTCGACATCATAAGAAACAGTTGCAGCACGATGAAGGACAAAACTCTTTGATGAAGAAAGTGTTCGACACGTACCTGCTGTTCTT

Function

GO:

id name namespace
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0005085 guanyl-nucleotide exchange factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-130530-773 Predicted to enable guanyl-nucleotide exchange factor activity. Predicted to act upstream of or within small GTPase mediated signal transduction. Orthologous to human DOCK10 (dedicator of cytokinesis 10).

Ensembl:

ensembl_id ENSDART00000155504

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00017629 lncRNA downstream 45749 1855023 ~ 1885239 (-) True XLOC_008923
TCONS_00017624 lncRNA downstream 96166 1830270 ~ 1834822 (-) False XLOC_008922
TCONS_00017613 lncRNA downstream 205504 1721587 ~ 1725484 (-) False XLOC_008918
TCONS_00017607 lncRNA downstream 319295 1606849 ~ 1611693 (-) False XLOC_008915
TCONS_00017604 lncRNA downstream 340193 1589813 ~ 1590795 (-) False XLOC_008914
TCONS_00017640 lncRNA upstream 382482 2323666 ~ 2328145 (-) False XLOC_008928
TCONS_00019112 lncRNA upstream 382482 2323666 ~ 2328284 (-) True XLOC_008928
TCONS_00017644 lncRNA upstream 576599 2517783 ~ 2519603 (-) True XLOC_008930
TCONS_00018809 lncRNA upstream 649197 2590381 ~ 2596121 (-) True XLOC_008931
TCONS_00017646 lncRNA upstream 657620 2598804 ~ 2611170 (-) True XLOC_008932
TCONS_00017628 mRNA downstream 45741 1847135 ~ 1885247 (-) False XLOC_008923
TCONS_00017622 mRNA downstream 86940 1825172 ~ 1844048 (-) False XLOC_008922
TCONS_00017633 mRNA upstream 13349 1954533 ~ 1962326 (-) False XLOC_008924
TCONS_00017634 mRNA upstream 28377 1969561 ~ 1992566 (-) True XLOC_008924
TCONS_00017635 mRNA upstream 109944 2051128 ~ 2052259 (-) True XLOC_008925
TCONS_00017636 mRNA upstream 240919 2182103 ~ 2188422 (-) False XLOC_008926
TCONS_00017637 mRNA upstream 241356 2182540 ~ 2184638 (-) False XLOC_008926
TCONS_00017627 other downstream 93105 1834971 ~ 1837883 (-) True XLOC_008922
TCONS_00017597 other downstream 609082 1321790 ~ 1321906 (-) True XLOC_008910
TCONS_00017537 other downstream 1505232 425695 ~ 425756 (-) True XLOC_008873
TCONS_00017535 other downstream 1581421 349451 ~ 349567 (-) True XLOC_008870
TCONS_00017639 other upstream 324785 2265969 ~ 2266083 (-) True XLOC_008927
TCONS_00017647 other upstream 683844 2625028 ~ 2625663 (-) True XLOC_008933
TCONS_00017655 other upstream 795199 2736383 ~ 2736498 (-) True XLOC_008940
TCONS_00017689 other upstream 2163224 4104408 ~ 4104526 (-) True XLOC_008968
TCONS_00017694 other upstream 2423974 4365158 ~ 4365272 (-) True XLOC_008973

Expression Profile

//