RNA id: TCONS_00017753


Basic Information

Item Value
RNA id TCONS_00017753
length 636
lncRNA type retained_intron
GC content 0.46
exon number 3
gene id XLOC_009005
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 5784212 ~ 5799183 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATGTTCTCTATACGATTTGCAACAACTGTGGTCCTGTTCAAAGAATCGTCATCTTTAGGAAGAACGGAGTCCAGGCCATGGTGGAATTTGATTCTGTTCAGAGCGCCCAAAGAGCCAAAGCCTCTCTCAATGGGGCTGATATATATTCCGGTTGTTGCACTCTAAAGATAGAGTATGCCAAGCCAACACGCCTTAATGTGTTCAAGAATGACCAGGACACATGGGACTACACCAATCCGAGCCTGGGCACTCAAGGTACTGTTAACCTTACTTCTGCTTTAGCATTTGTCAGCGCCCTTACTGCCACTGTGACGGAAATAAGCGGGTGGGCTTGGGGAATCCTAGAACCGCATTAATAAATCCGCTGTTTCACCTCCCCTGTGCTGAGTGTTAGGCATACCAGCATCTACACAACATGTTGTGCTTGTTCTCGTGACTCTTAAGGGGAGGTCAAATCGTAACACTCTGATCAAACTAAGGCTTCCTCAATGTTATCCTGCTGATATCTTACAGACTTCTTTTTCCAGCAAAGCCTGTCACATGAAGTGTGAGGGGCAAGTGGCTTTTTGGGAAAGCACCATAAACGTGGCCTTATCCATGGACAACCCTGATATCTTTTGATATCAAGAGACTTG

Function

GO:

id name namespace
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0005634 nucleus cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2707 Predicted to enable RNA binding activity. Predicted to act upstream of or within mRNA processing. Predicted to be located in viral nucleocapsid. Predicted to be active in nucleus. Human ortholog(s) of this gene implicated in hepatocellular carcinoma; lung cancer; and systemic scleroderma. Orthologous to human HNRNPL (heterogeneous nuclear ribonucleoprotein L).

Ensembl:

ensembl_id ENSDART00000146815

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00017751 lncRNA downstream 3632 5787186 ~ 5791331 (-) False XLOC_009005
TCONS_00018811 lncRNA downstream 577257 5215808 ~ 5217706 (-) True XLOC_008989
TCONS_00018810 lncRNA downstream 591796 5202251 ~ 5203167 (-) True XLOC_008986
TCONS_00017703 lncRNA downstream 1309096 4445060 ~ 4485867 (-) True XLOC_008974
TCONS_00017701 lncRNA downstream 1349365 4429018 ~ 4445598 (-) False XLOC_008974
TCONS_00017759 lncRNA upstream 100492 5898410 ~ 5901485 (-) False XLOC_009008
TCONS_00019119 lncRNA upstream 100492 5898410 ~ 5901982 (-) False XLOC_009008
TCONS_00017758 lncRNA upstream 100986 5898904 ~ 5901478 (-) False XLOC_009008
TCONS_00017760 lncRNA upstream 101268 5899186 ~ 5901478 (-) True XLOC_009008
TCONS_00017775 lncRNA upstream 1170463 6968381 ~ 6976921 (-) False XLOC_009014
TCONS_00017747 mRNA downstream 14315 5773119 ~ 5780648 (-) False XLOC_009004
TCONS_00017748 mRNA downstream 14370 5773122 ~ 5780593 (-) True XLOC_009004
TCONS_00017745 mRNA downstream 52432 5722525 ~ 5742531 (-) False XLOC_009003
TCONS_00017746 mRNA downstream 54605 5723913 ~ 5740358 (-) True XLOC_009003
TCONS_00017744 mRNA downstream 74297 5632565 ~ 5720666 (-) True XLOC_009002
TCONS_00017754 mRNA upstream 5540 5803458 ~ 5815006 (-) True XLOC_009006
TCONS_00017755 mRNA upstream 31076 5828994 ~ 5892650 (-) False XLOC_009007
TCONS_00017756 mRNA upstream 89930 5887848 ~ 5895124 (-) True XLOC_009007
TCONS_00017757 mRNA upstream 100492 5898410 ~ 5901514 (-) False XLOC_009008
TCONS_00017761 mRNA upstream 340505 6138423 ~ 6247775 (-) False XLOC_009009
TCONS_00017735 other downstream 411783 5383062 ~ 5383180 (-) True XLOC_008997
TCONS_00017702 other downstream 1312733 4435465 ~ 4482230 (-) False XLOC_008974
TCONS_00017700 other downstream 1312816 4426494 ~ 4482147 (-) False XLOC_008974
TCONS_00017694 other downstream 1429691 4365158 ~ 4365272 (-) True XLOC_008973
TCONS_00017689 other downstream 1690437 4104408 ~ 4104526 (-) True XLOC_008968
TCONS_00017769 other upstream 1129100 6927018 ~ 6946091 (-) False XLOC_009012
TCONS_00017770 other upstream 1140970 6938888 ~ 6940927 (-) True XLOC_009012
TCONS_00017772 other upstream 1150753 6948671 ~ 6966239 (-) False XLOC_009013
TCONS_00017773 other upstream 1150975 6948893 ~ 6966245 (-) False XLOC_009013
TCONS_00017778 other upstream 1210904 7008822 ~ 7008938 (-) True XLOC_009015

Expression Profile

//