RNA id: TCONS_00018177


Basic Information

Item Value
RNA id TCONS_00018177
length 470
RNA type mRNA
GC content 0.51
exon number 4
gene id XLOC_009246
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 25321572 ~ 25367309 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCACATGGAAAGTCATGGTGCATGTATGCCGATAGAAGGTTATTGCTACCAGTTAAATATAGAGGGATCTGTTTGGGCACGGTGTTGAGACAGCAGTGATGAACGGGGATGCGGGTCATGATCAGGCGGAGGAGGCCGACTCAAAGCAGGACGGCAGTGGCGACGCAGACCAAGCAGAAGATGCTAACGAACAAGAAGTAATCGTAATTCAAGACACTGGCTTCACTGTGAAGATCCAAGCACCAGGAACCGAACCCTTTGACCTTCAGGTGTCTCCACAAGAGATGGTACAGGAGATTCATCAAGTTCTGATGGACCGAGAGGACACCTGCCATCGCACCTGCTTCTCCTTACAGCTCGACGGAAATGTTCTCGACAACTTTGCCGAGCTGAAATCCATCGAGGGCCTTCAGGAAGGCTCGCTTCTTAAAGTGGTCGAAGAGCCCTACACAGTGCGTGAAGCTCGCATT

Function

GO:

id name namespace
GO:0048312 intracellular distribution of mitochondria biological_process
GO:0005737 cytoplasm cellular_component
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-061103-457 Predicted to enable mRNA binding activity. Predicted to be involved in intracellular distribution of mitochondria. Predicted to be active in cytoplasm. Is expressed in several structures, including adaxial cell; eye; midbrain; musculature system; and pleuroperitoneal region. Orthologous to human CLUH (clustered mitochondria homolog).

Ensembl:

ensembl_id ENSDART00000152651

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018168 lncRNA downstream 127761 25215128 ~ 25229469 (-) False XLOC_009244
TCONS_00018824 lncRNA downstream 383118 24968092 ~ 24974112 (-) True XLOC_009236
TCONS_00019162 lncRNA downstream 434782 24904402 ~ 24922448 (-) False XLOC_009234
TCONS_00019161 lncRNA downstream 434819 24904402 ~ 24922411 (-) False XLOC_009234
TCONS_00019160 lncRNA downstream 448405 24904402 ~ 24908825 (-) False XLOC_009234
TCONS_00019163 lncRNA upstream 333493 25698812 ~ 25760624 (-) False XLOC_009254
TCONS_00019164 lncRNA upstream 333493 25698812 ~ 25876114 (-) False XLOC_009254
TCONS_00019165 lncRNA upstream 353425 25718744 ~ 25760609 (-) False XLOC_009254
TCONS_00018193 lncRNA upstream 353425 25718744 ~ 25760634 (-) False XLOC_009254
TCONS_00018192 lncRNA upstream 353425 25718744 ~ 25760643 (-) False XLOC_009254
TCONS_00018175 mRNA downstream 7421 25345326 ~ 25349809 (-) False XLOC_009246
TCONS_00018171 mRNA downstream 37567 25273185 ~ 25319663 (-) False XLOC_009245
TCONS_00018172 mRNA downstream 52520 25273470 ~ 25304710 (-) False XLOC_009245
TCONS_00018167 mRNA downstream 88202 25214171 ~ 25269028 (-) False XLOC_009244
TCONS_00018178 mRNA upstream 10604 25375923 ~ 25392589 (-) True XLOC_009247
TCONS_00018179 mRNA upstream 32808 25398127 ~ 25435085 (-) True XLOC_009248
TCONS_00018180 mRNA upstream 136545 25501864 ~ 25518084 (-) False XLOC_009249
TCONS_00018181 mRNA upstream 138634 25503953 ~ 25527580 (-) False XLOC_009249
TCONS_00018182 mRNA upstream 139611 25504930 ~ 25527581 (-) True XLOC_009249
TCONS_00018173 other downstream 73185 25278845 ~ 25284045 (-) True XLOC_009245
TCONS_00018169 other downstream 88589 25238489 ~ 25268641 (-) False XLOC_009244
TCONS_00018157 other downstream 263513 25084821 ~ 25093717 (-) False XLOC_009240
TCONS_00018151 other downstream 448751 24908394 ~ 24908479 (-) True XLOC_009234
TCONS_00018142 other downstream 1198163 24158953 ~ 24159067 (-) True XLOC_009227
TCONS_00018187 other upstream 212869 25578188 ~ 25579500 (-) False XLOC_009252
TCONS_00018188 other upstream 213156 25578475 ~ 25584862 (-) True XLOC_009252
TCONS_00018197 other upstream 629661 25994980 ~ 25995095 (-) True XLOC_009256
TCONS_00018199 other upstream 710044 26075363 ~ 26075480 (-) True XLOC_009257
TCONS_00018200 other upstream 909321 26274640 ~ 26274757 (-) True XLOC_009259

Expression Profile

//