RNA id: TCONS_00018205


Basic Information

Item Value
RNA id TCONS_00018205
length 623
RNA type mRNA
GC content 0.44
exon number 5
gene id XLOC_009263
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 26540981 ~ 26552652 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATCAATATCAACATTGGCAGTGCTGTCTTGTCATCTCCTCCTCATTAATTTTTCTAATGCCGCAAGTTTACTCATATTCATAGCCTCACATGCACTGTCAGCAGTGAGTTTATTTAGCTAAGCAAACTAGACAATTCCAATTTATAACTTACTTTGTTCAAGCTATTCACAGATCCAGCTATCTACACACTTGAGTTTGATGTTCGACCTCAAGGTCTCTCAATATTTACATCTATGAAGAGGGCTGGATCCCACTCCTGGAGATTTGCACGACTAACTTCTAGAACATGAACTTGTGTTTTCTGGCATTCCTCCTCCTTTGTTACTCCAAGCAAGGCTGGACGGACGATGTGACTGATCCAGAGGATGGAGTGGATCCTGTAATTCCTCTCATTCCACTGACTCCAAGTAAACCCATATCAGATTTGAAGGCCACTCTTGACCCCACTGTAACAGAAGAACTCACAGTTAATCCAGATGGCCTGGAAGCAGATCCTCCAACACCAGGTCCCTCTAGTGGGCAGAAAGAGGGATCGTCGGAGGAAGAGCTTGATACCCTTTGTGATGGGGACATGACAGGCAAACAGATAAAACGGACCATAGGCAACGGCATTATGAAGCTT

Function

GO:

id name namespace
GO:0010951 negative regulation of endopeptidase activity biological_process
GO:0005615 extracellular space cellular_component
GO:0004867 serine-type endopeptidase inhibitor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-061215-114 Predicted to enable serine-type endopeptidase inhibitor activity. Predicted to be involved in negative regulation of endopeptidase activity. Predicted to be active in extracellular space. Human ortholog(s) of this gene implicated in COVID-19 and alpha-2-plasmin inhibitor deficiency. Orthologous to human SERPINF2 (serpin family F member 2).

Ensembl:

ensembl_id ENSDART00000152336

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019170 lncRNA downstream 52946 26471336 ~ 26496219 (-) True XLOC_009261
TCONS_00018827 lncRNA downstream 365191 26117194 ~ 26183974 (-) True XLOC_009258
TCONS_00019169 lncRNA downstream 673045 25764525 ~ 25876120 (-) True XLOC_009254
TCONS_00019168 lncRNA downstream 673052 25764525 ~ 25876113 (-) False XLOC_009254
TCONS_00019167 lncRNA downstream 788502 25738920 ~ 25760663 (-) False XLOC_009254
TCONS_00018828 lncRNA upstream 91707 26644359 ~ 26647276 (-) True XLOC_009266
TCONS_00018216 lncRNA upstream 439457 26992109 ~ 26994461 (-) True XLOC_009270
TCONS_00018218 lncRNA upstream 750627 27303279 ~ 27305901 (-) False XLOC_009271
TCONS_00018220 lncRNA upstream 750627 27303279 ~ 27305916 (-) False XLOC_009271
TCONS_00018217 lncRNA upstream 750627 27303279 ~ 27306012 (-) False XLOC_009271
TCONS_00018202 mRNA downstream 10176 26498339 ~ 26538989 (-) True XLOC_009262
TCONS_00018196 mRNA downstream 460101 25910501 ~ 26089064 (-) False XLOC_009255
TCONS_00018198 mRNA downstream 460153 26045590 ~ 26089012 (-) True XLOC_009255
TCONS_00018191 mRNA downstream 936051 25595646 ~ 25613114 (-) False XLOC_009253
TCONS_00018206 mRNA upstream 296 26552948 ~ 26570948 (-) False XLOC_009264
TCONS_00018207 mRNA upstream 2077 26554729 ~ 26568278 (-) True XLOC_009264
TCONS_00018208 mRNA upstream 63352 26616004 ~ 26636826 (-) True XLOC_009265
TCONS_00018209 mRNA upstream 126182 26678834 ~ 26844591 (-) False XLOC_009267
TCONS_00018210 mRNA upstream 130893 26683545 ~ 26686908 (-) True XLOC_009267
TCONS_00018201 other downstream 250418 26298629 ~ 26298747 (-) True XLOC_009260
TCONS_00018200 other downstream 274408 26274640 ~ 26274757 (-) True XLOC_009259
TCONS_00018199 other downstream 473685 26075363 ~ 26075480 (-) True XLOC_009257
TCONS_00018197 other downstream 554070 25994980 ~ 25995095 (-) True XLOC_009256
TCONS_00018188 other downstream 964303 25578475 ~ 25584862 (-) True XLOC_009252
TCONS_00018239 other upstream 1093767 27646419 ~ 27646536 (-) True XLOC_009276
TCONS_00018240 other upstream 1101524 27654176 ~ 27654292 (-) True XLOC_009277
TCONS_00018243 other upstream 1370326 27922978 ~ 27923093 (-) True XLOC_009281
TCONS_00018264 other upstream 1822861 28375513 ~ 28375627 (-) True XLOC_009292
TCONS_00018276 other upstream 2182275 28734927 ~ 28735041 (-) True XLOC_009299

Expression Profile

//