RNA id: TCONS_00018229


Basic Information

Item Value
RNA id TCONS_00018229
length 647
lncRNA type inter_gene
GC content 0.42
exon number 2
gene id XLOC_009272
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 27352522 ~ 27364490 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAAGGACCGGGTCAGCCCTCAGTGCTTAGCCGGTGGTGACTGCACCTCGGTCGGCTTACGCTTTATAATTACGATGCCTCCTTGTTCGAGGAACAAAACACTCTTTCCGATACACAGACAACCAAGACTTAAGATTATTGACGTGTAAATGAGAACGTTGCAAACTCTTATGAGAAAATCAGCGCAAATACTATAAACTTTACATTACAAGCACATTTAAAGCATCGTGAATTGAAGATAACTTTTCGCAATAGTCAATAAAATAGCACACACAAAACAACGTTCATGTTCGCTGTATATGTTGAAGTGGCGCGTACGTATTTTGTTAATGATACAGAAGTGCACACTGATAGCCAAAGGACCTTGTTGTGCGTATGAATTGAATTCAGCGTAACACTGTGTGAATAACAATTTCCGTACTTCGTTCGTGTGTCGCGACTGACTTCATGTGGGGAACATCAGCCAATAACCGGACATTGGTACTTTCAATTCTGCCCCGGGTCATTCAAAGCGCATAGCCACGCGCTATGAAGAAAAAGGAAGAGAGCTGATGGAATCTAAAGACCAATGTAAAGATAATTTTGTTAAGAGATGCATGACCTCCGATGAGAGGAGAAACCCACAGACATGCCAGAAAATAGCCTTTT

Function

GO:

id name namespace
GO:0072068 late distal convoluted tubule development biological_process
GO:0010605 negative regulation of macromolecule metabolic process biological_process
GO:0048731 system development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0021536 diencephalon development biological_process
GO:0048468 cell development biological_process
GO:0046530 photoreceptor cell differentiation biological_process
GO:0021545 cranial nerve development biological_process
GO:0010629 negative regulation of gene expression biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0021554 optic nerve development biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0007507 heart development biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006928 movement of cell or subcellular component biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0043010 camera-type eye development biological_process
GO:0006935 chemotaxis biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0051172 negative regulation of nitrogen compound metabolic process biological_process
GO:0030154 cell differentiation biological_process
GO:0048513 animal organ development biological_process
GO:0000902 cell morphogenesis biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0048519 negative regulation of biological process biological_process
GO:0048523 negative regulation of cellular process biological_process
GO:0035295 tube development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0021602 cranial nerve morphogenesis biological_process
GO:0090596 sensory organ morphogenesis biological_process
GO:0021603 cranial nerve formation biological_process
GO:0030182 neuron differentiation biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0009890 negative regulation of biosynthetic process biological_process
GO:0019857 5-methylcytosine metabolic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0031324 negative regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0031327 negative regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:0120039 plasma membrane bounded cell projection morphogenesis biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048568 embryonic organ development biological_process
GO:1902679 negative regulation of RNA biosynthetic process biological_process
GO:0051239 regulation of multicellular organismal process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:0051253 negative regulation of RNA metabolic process biological_process
GO:0048858 cell projection morphogenesis biological_process
GO:0048592 eye morphogenesis biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0048593 camera-type eye morphogenesis biological_process
GO:1903507 negative regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0045595 regulation of cell differentiation biological_process
GO:2000026 regulation of multicellular organismal development biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0032990 cell part morphogenesis biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0048880 sensory system development biological_process
GO:0021675 nerve development biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0008283 cell population proliferation biological_process
GO:0045892 negative regulation of transcription, DNA-templated biological_process
GO:0050767 regulation of neurogenesis biological_process
GO:0040011 locomotion biological_process
GO:0006211 5-methylcytosine catabolic process biological_process
GO:0097485 neuron projection guidance biological_process
GO:1904888 cranial skeletal system development biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0061564 axon development biological_process
GO:0048666 neuron development biological_process
GO:0050793 regulation of developmental process biological_process
GO:0048667 cell morphogenesis involved in neuron differentiation biological_process
GO:0007399 nervous system development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0045934 negative regulation of nucleobase-containing compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0007409 axonogenesis biological_process
GO:0007411 axon guidance biological_process
GO:0060284 regulation of cell development biological_process
GO:0001654 eye development biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0042330 taxis biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0072025 distal convoluted tubule development biological_process
GO:0010558 negative regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0007423 sensory organ development biological_process
GO:0030900 forebrain development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0022008 neurogenesis biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:2000113 negative regulation of cellular macromolecule biosynthetic process biological_process
GO:0060041 retina development in camera-type eye biological_process
GO:0060042 retina morphogenesis in camera-type eye biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0060322 head development biological_process
GO:0009790 embryo development biological_process
GO:0150063 visual system development biological_process
GO:0051960 regulation of nervous system development biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0048495 Roundabout binding molecular_function
GO:0070579 methylcytosine dioxygenase activity molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0005200 structural constituent of cytoskeleton molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00019173 lncRNA downstream 50271 27303688 ~ 27307088 (-) False XLOC_009271
TCONS_00018223 lncRNA downstream 50271 27303784 ~ 27307088 (-) False XLOC_009271
TCONS_00019172 lncRNA downstream 50718 27303688 ~ 27306641 (-) False XLOC_009271
TCONS_00018227 lncRNA downstream 50724 27305043 ~ 27306635 (-) True XLOC_009271
TCONS_00018224 lncRNA downstream 51259 27303688 ~ 27306100 (-) False XLOC_009271
TCONS_00019175 lncRNA upstream 27387 27391544 ~ 27414001 (-) False XLOC_009273
TCONS_00018829 lncRNA upstream 27400 27391557 ~ 27391907 (-) True XLOC_009273
TCONS_00018238 lncRNA upstream 278076 27642233 ~ 27658419 (-) False XLOC_009275
TCONS_00019176 lncRNA upstream 292689 27656846 ~ 27658455 (-) True XLOC_009275
TCONS_00018830 lncRNA upstream 296088 27660245 ~ 27661117 (-) True XLOC_009278
TCONS_00018214 mRNA downstream 425818 26904635 ~ 26931541 (-) False XLOC_009269
TCONS_00018213 mRNA downstream 426360 26903267 ~ 26930999 (-) False XLOC_009269
TCONS_00018212 mRNA downstream 426360 26903267 ~ 26930999 (-) False XLOC_009269
TCONS_00018215 mRNA downstream 433366 26919222 ~ 26923993 (-) True XLOC_009269
TCONS_00018211 mRNA downstream 470331 26848909 ~ 26887028 (-) True XLOC_009268
TCONS_00018231 mRNA upstream 51615 27415772 ~ 27522838 (-) False XLOC_009274
TCONS_00018230 mRNA upstream 51615 27415772 ~ 27522838 (-) False XLOC_009274
TCONS_00018232 mRNA upstream 52958 27417115 ~ 27522838 (-) False XLOC_009274
TCONS_00018233 mRNA upstream 54764 27418921 ~ 27522838 (-) False XLOC_009274
TCONS_00018234 mRNA upstream 73254 27437411 ~ 27522838 (-) False XLOC_009274
TCONS_00018201 other downstream 1058612 26298629 ~ 26298747 (-) True XLOC_009260
TCONS_00018200 other downstream 1082602 26274640 ~ 26274757 (-) True XLOC_009259
TCONS_00018199 other downstream 1281879 26075363 ~ 26075480 (-) True XLOC_009257
TCONS_00018197 other downstream 1362264 25994980 ~ 25995095 (-) True XLOC_009256
TCONS_00018188 other downstream 1772497 25578475 ~ 25584862 (-) True XLOC_009252
TCONS_00018239 other upstream 282262 27646419 ~ 27646536 (-) True XLOC_009276
TCONS_00018240 other upstream 290019 27654176 ~ 27654292 (-) True XLOC_009277
TCONS_00018243 other upstream 558821 27922978 ~ 27923093 (-) True XLOC_009281
TCONS_00018264 other upstream 1011356 28375513 ~ 28375627 (-) True XLOC_009292
TCONS_00018276 other upstream 1370770 28734927 ~ 28735041 (-) True XLOC_009299

Expression Profile

//