RNA id: TCONS_00018242


Basic Information

Item Value
RNA id TCONS_00018242
length 433
RNA type mRNA
GC content 0.49
exon number 3
gene id XLOC_009279
representative True

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 27703409 ~ 27710575 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTACCTCATGAGAAAATCTTCTATCGTCTTCATTTTGGACCCCTACAGGTCCACCCACAAACGCAGAACTGAGAGAAATCAGGAGCAGAGCCTCAGGTTGTGGACACCACGGCAGTAACTGTGGGAGCACATCCAAAGACGATGGTCCACTGTGCGGGCTGCGAGAGGCCTATATTGGACAGGTTTCTCCTTAATGTTCTGGACAGAGCATGGCACATCAAGTGCGTACAGTGCTGCGAGTGCAAATGTAACCTAACAGAGAAATGCTTCTCTCGAGAAGGAAAACTATATTGCAAAAACGACTTCTTTAGGCGCTTTGGAACAAAATGTGCGGGTTGTGCTCAGGGGATCTCGCCGAATGACTTGGTCCGGAGGGCACGGAGCAAAGTGTTTCATCTGAACTGCTTCACATGCATGATGTGTAACAAGCAGC

Function

GO:

id name namespace
GO:0001705 ectoderm formation biological_process
GO:0001706 endoderm formation biological_process
GO:0021527 spinal cord association neuron differentiation biological_process
GO:0072077 renal vesicle morphogenesis biological_process
GO:0090009 primitive streak formation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:2000744 positive regulation of anterior head development biological_process
GO:0097379 dorsal spinal cord interneuron posterior axon guidance biological_process
GO:0009880 embryonic pattern specification biological_process
GO:0030182 neuron differentiation biological_process
GO:0007275 multicellular organism development biological_process
GO:0021871 forebrain regionalization biological_process
GO:0061205 paramesonephric duct development biological_process
GO:2000768 positive regulation of nephron tubule epithelial cell differentiation biological_process
GO:0072178 nephric duct morphogenesis biological_process
GO:2000543 positive regulation of gastrulation biological_process
GO:0009953 dorsal/ventral pattern formation biological_process
GO:0021937 cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation biological_process
GO:0045892 negative regulation of transcription, DNA-templated biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0097477 lateral motor column neuron migration biological_process
GO:0040019 positive regulation of embryonic development biological_process
GO:0021702 cerebellar Purkinje cell differentiation biological_process
GO:0008045 motor neuron axon guidance biological_process
GO:0090190 positive regulation of branching involved in ureteric bud morphogenesis biological_process
GO:0001657 ureteric bud development biological_process
GO:0010842 retina layer formation biological_process
GO:0072049 comma-shaped body morphogenesis biological_process
GO:0072050 S-shaped body morphogenesis biological_process
GO:0060059 embryonic retina morphogenesis in camera-type eye biological_process
GO:0060322 head development biological_process
GO:0009791 post-embryonic development biological_process
GO:0032991 protein-containing complex cellular_component
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-980526-347 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in several processes, including animal organ development; gastrulation; and regulation of transcription, DNA-templated. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be part of protein-containing complex. Predicted to be active in nucleus. Is expressed in several structures, including axis; mesoderm; nervous system; renal system; and shield. Orthologous to human LHX1 (LIM homeobox 1).

Ensembl:

ensembl_id ENSDART00000134373

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00018830 lncRNA downstream 47622 27660245 ~ 27661117 (-) True XLOC_009278
TCONS_00019176 lncRNA downstream 50284 27656846 ~ 27658455 (-) True XLOC_009275
TCONS_00018238 lncRNA downstream 50320 27642233 ~ 27658419 (-) False XLOC_009275
TCONS_00019175 lncRNA downstream 294738 27391544 ~ 27414001 (-) False XLOC_009273
TCONS_00019179 lncRNA upstream 73975 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00019178 lncRNA upstream 73975 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00019177 lncRNA upstream 73975 27784550 ~ 27884677 (-) False XLOC_009280
TCONS_00019180 lncRNA upstream 73975 27784550 ~ 27956162 (-) False XLOC_009280
TCONS_00019181 lncRNA upstream 80552 27791127 ~ 27956019 (-) False XLOC_009280
TCONS_00018230 mRNA downstream 185901 27415772 ~ 27522838 (-) False XLOC_009274
TCONS_00018244 mRNA upstream 260723 27971298 ~ 27972474 (-) True XLOC_009282
TCONS_00018245 mRNA upstream 296193 28006768 ~ 28082310 (-) False XLOC_009283
TCONS_00018246 mRNA upstream 348416 28058991 ~ 28085563 (-) False XLOC_009283
TCONS_00018247 mRNA upstream 368471 28079046 ~ 28085480 (-) True XLOC_009283
TCONS_00018248 mRNA upstream 375618 28086193 ~ 28095532 (-) False XLOC_009285
TCONS_00018240 other downstream 54447 27654176 ~ 27654292 (-) True XLOC_009277
TCONS_00018239 other downstream 62203 27646419 ~ 27646536 (-) True XLOC_009276
TCONS_00018201 other downstream 1409992 26298629 ~ 26298747 (-) True XLOC_009260
TCONS_00018200 other downstream 1433982 26274640 ~ 26274757 (-) True XLOC_009259
TCONS_00018199 other downstream 1633259 26075363 ~ 26075480 (-) True XLOC_009257
TCONS_00018243 other upstream 212403 27922978 ~ 27923093 (-) True XLOC_009281
TCONS_00018264 other upstream 664938 28375513 ~ 28375627 (-) True XLOC_009292
TCONS_00018276 other upstream 1024352 28734927 ~ 28735041 (-) True XLOC_009299
TCONS_00018305 other upstream 1674558 29385133 ~ 29386439 (-) True XLOC_009309
TCONS_00018320 other upstream 1959617 29670192 ~ 29670306 (-) True XLOC_009318

Expression Profile

//