RNA id: TCONS_00019961



Basic Information


Item Value
RNA id TCONS_00019961
length 529
RNA type processed_transcript
GC content 0.48
exon number 4
gene id XLOC_010037
representative True

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 31827502 ~ 31837482 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GGACATGTTCAGCATGATGAGTGGAATGATGGAGAACATGGAACGAATGTCTGGTTCTCCAAACTGCCAGACCTTTTCCTCCTCGACAGTCATCTCGTACTCCTCTACAGACCCAGGAACACCTAAAGTCTATCAGCAGACCAGTGAATATCGCACTGCTCCCGGGGGTATCAGAGAGACGCGTCAAACGATGCGGGACAGTCAGAGCGGGCTGGAGCGAATGTCTATTGGGCATCACATTGGTGAGAGAGGTCATGTGATGGAGCGTTCCAGGAACCGTCTCACAGGCGATCAGAAGAAAAATTATAACCGATGGGTCAAATGTTTGATAGATCTGAACTGTCTCAATATGTGTAGTCAGCTTCTTACAGGAACATGTGCTGGCATGAGGTATCATAACACGGGCTGAAGAGTTTAGAATGCATCCCCGTTGTGTGTAATTCGGCCTGGTCTGTGTACTTCATACCACGTTACTGCTCCCAAAGCATACACACCAGCATCCATCATATTTCAAACAGCTCTTCAACCT

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-050913-67 Predicted to be involved in regulation of transcription, DNA-templated. Predicted to be active in cytoplasm and nucleus. Orthologous to human MLF2 (myeloid leukemia factor 2).

Ensembl:

ensembl_id ENSDART00000135746

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00021726 lncRNA upstream 693607 31121756 ~ 31135431 (+) True XLOC_010031
TCONS_00021725 lncRNA upstream 700954 31121756 ~ 31128084 (+) False XLOC_010031
TCONS_00021968 lncRNA upstream 734458 31090998 ~ 31094580 (+) True XLOC_010030
TCONS_00021966 lncRNA upstream 1498157 30329863 ~ 30330881 (+) False XLOC_010024
TCONS_00021969 lncRNA downstream 124421 31960908 ~ 31985059 (+) False XLOC_010041
TCONS_00019972 lncRNA downstream 124429 31960916 ~ 31970381 (+) True XLOC_010041
TCONS_00021970 lncRNA downstream 256225 32092712 ~ 32095588 (+) False XLOC_010047
TCONS_00019987 lncRNA downstream 430632 32267119 ~ 32270270 (+) True XLOC_010051
TCONS_00021971 lncRNA downstream 442512 32278999 ~ 32314568 (+) False XLOC_010052
TCONS_00019957 mRNA upstream 16020 31802203 ~ 31813018 (+) False XLOC_010036
TCONS_00019956 mRNA upstream 16023 31802203 ~ 31813015 (+) False XLOC_010036
TCONS_00019958 mRNA upstream 16149 31804590 ~ 31812889 (+) True XLOC_010036
TCONS_00019954 mRNA upstream 281238 31542645 ~ 31547800 (+) True XLOC_010034
TCONS_00019953 mRNA upstream 311811 31511739 ~ 31517227 (+) True XLOC_010033
TCONS_00019962 mRNA downstream 17432 31853919 ~ 31868985 (+) True XLOC_010038
TCONS_00019964 mRNA downstream 85325 31921812 ~ 31927522 (+) False XLOC_010039
TCONS_00019963 mRNA downstream 85325 31921812 ~ 31927522 (+) False XLOC_010039
TCONS_00019965 mRNA downstream 85578 31922065 ~ 31923503 (+) False XLOC_010039
TCONS_00019966 mRNA downstream 85669 31922156 ~ 31923503 (+) False XLOC_010039
TCONS_00019955 other upstream 194443 31634470 ~ 31634595 (+) True XLOC_010035
TCONS_00019951 other upstream 857881 30970501 ~ 30971157 (+) True XLOC_010029
TCONS_00019939 other upstream 1748377 30080543 ~ 30080661 (+) True XLOC_010021
TCONS_00019938 other upstream 1792345 30002752 ~ 30036693 (+) False XLOC_010020
TCONS_00019912 other upstream 2612678 29216274 ~ 29216360 (+) True XLOC_010005
TCONS_00019968 other downstream 86300 31922787 ~ 31923924 (+) True XLOC_010039
TCONS_00019985 other downstream 355710 32192197 ~ 32196767 (+) True XLOC_010050
TCONS_00019992 other downstream 836333 32672820 ~ 32672936 (+) True XLOC_010055
TCONS_00020010 other downstream 1506664 33343151 ~ 33343265 (+) True XLOC_010067
TCONS_00020013 other downstream 1883482 33719969 ~ 33733378 (+) True XLOC_010069

Expression Profile


//