RNA id: TCONS_00020028



Basic Information


Item Value
RNA id TCONS_00020028
length 1055
RNA type mRNA
GC content 0.46
exon number 10
gene id XLOC_010078
representative False

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 34111919 ~ 34135244 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTTTTCTCAACTGACCGTTCAGGAGCAACTCAAGTTTGGGAACAAAACTTCAAACATTTCGCTGAATTATAAAGATTTATGTGACTTGACGTACTATACACACTTGATTTTCACTTACAGCATATTAATGCGCACACAATGACGCGAGAGGAGGACCTGTTGCGGATTGCCAAAAAACTAGACAAGATGGTGTCTAGAAATAACATGGATGGAGCTCTAGATCTTCTGAGAGAATTGAAAGATTTCAACATGACACTGAAACTTCTTCAGGATACAAGAATCGGCATGTCCGTCAATGGAATAAGAAAACATTGCACAGACGAGGATGTTGTCAACTTGGCAAAGATTCTGATCAAAAACTGGAAGAGGCTTTTAGAATCAGCTCAGAACCCAAAATCTGAGAGGCCAAATGAGGTGAAGAACGGCAGTCATCCAAGCAAGCCATCGGGATCACCCAGCAGGACTTCTCCTGAGAAAGACTCCAGAAAGGACTCCACAGATTCCAAAAAGCCTCTTCCTAGGAAGCCGAGCCTGGATGGACGAAGAGACAGTAAGGACTCTACTGACTCCAAGTCAAGCAATCACCTTTTGAAACGACAATCAAGTGAGCCAAAATTGGAGAGGCGAGATTCTACTAACTCAAGGTCTGGCAGCTCACCTCAGGCCAAGAAATCCTGTGAAAGCAAGAGTAAACCAGAGACCCCAAAGACGCCCACAACACCCACAAGCCCCCTGTCCCCATCCTTCAGCTCCAGTGCGGGGCCTTTATCTCCTCGCCTGCAAACCGGAGACTCCATCAGGGACAAATGCATCGAAATGCTGACTGCTGCGCTCCGTACAGATGATGACTACAAAGACTATGGGACAAACTGCGAAGCTATGGGTGCAGAAATCGAGGATTATATATACCAGGAGACAAAAGCCACAGACATGAAATACAAAAACAGAGTCCGCAGCCGCATTAGTAACCTGAAGGATCCCAAAAATCCCAATCTGCGCAAAAATGTCTTGGCAGGGGCAATCGAGTTGAGCCGCATCGCCTCCATGACTGCTGA

Function


GO:

id name namespace
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006412 translation biological_process
GO:0006414 translational elongation biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0008270 zinc ion binding molecular_function
GO:0003746 translation elongation factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1860 Predicted to enable translation elongation factor activity and zinc ion binding activity. Predicted to act upstream of or within regulation of transcription, DNA-templated; transcription, DNA-templated; and translational elongation. Predicted to be located in nucleus. Is expressed in adaxial cell; musculature system; neuromast; and somite. Orthologous to human TCEA3 (transcription elongation factor A3).

Ensembl:

ensembl_id ENSDART00000134037

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00020024 lncRNA upstream 118460 33992319 ~ 33993459 (+) False XLOC_010076
TCONS_00020020 lncRNA upstream 168191 33939990 ~ 33943728 (+) True XLOC_010073
TCONS_00021975 lncRNA upstream 355540 33752361 ~ 33756379 (+) True XLOC_010070
TCONS_00021728 lncRNA upstream 818139 33291419 ~ 33293780 (+) True XLOC_010066
TCONS_00020009 lncRNA upstream 823711 33255079 ~ 33288208 (+) False XLOC_010066
TCONS_00021976 lncRNA downstream 183791 34315762 ~ 34321379 (+) True XLOC_010080
TCONS_00021977 lncRNA downstream 187918 34319889 ~ 34323007 (+) True XLOC_010081
TCONS_00020032 lncRNA downstream 347026 34478997 ~ 34502203 (+) False XLOC_010082
TCONS_00020033 lncRNA downstream 362016 34493987 ~ 34502203 (+) False XLOC_010082
TCONS_00021978 lncRNA downstream 365129 34497100 ~ 34502203 (+) True XLOC_010082
TCONS_00020027 mRNA upstream 55476 34046733 ~ 34056443 (+) True XLOC_010077
TCONS_00020025 mRNA upstream 105584 33992418 ~ 34006335 (+) False XLOC_010076
TCONS_00020026 mRNA upstream 105587 33992506 ~ 34006332 (+) True XLOC_010076
TCONS_00020023 mRNA upstream 121195 33987892 ~ 33990724 (+) True XLOC_010075
TCONS_00020022 mRNA upstream 125123 33953644 ~ 33986796 (+) True XLOC_010074
TCONS_00020031 mRNA downstream 28864 34160835 ~ 34174260 (+) True XLOC_010079
TCONS_00020034 mRNA downstream 391006 34522977 ~ 34532805 (+) False XLOC_010083
TCONS_00020035 mRNA downstream 391544 34523515 ~ 34527206 (+) True XLOC_010084
TCONS_00020036 mRNA downstream 396438 34528409 ~ 34531851 (+) False XLOC_010083
TCONS_00020037 mRNA downstream 399515 34531486 ~ 34532888 (+) True XLOC_010083
TCONS_00020014 other upstream 355540 33752102 ~ 33756379 (+) False XLOC_010070
TCONS_00020013 other upstream 378541 33719969 ~ 33733378 (+) True XLOC_010069
TCONS_00020010 other upstream 768654 33343151 ~ 33343265 (+) True XLOC_010067
TCONS_00019992 other upstream 1438983 32672820 ~ 32672936 (+) True XLOC_010055
TCONS_00019985 other upstream 1915152 32192197 ~ 32196767 (+) True XLOC_010050
TCONS_00020038 other downstream 592597 34724568 ~ 34724682 (+) True XLOC_010085
TCONS_00020039 other downstream 1074884 35206855 ~ 35280788 (+) True XLOC_010087
TCONS_00020045 other downstream 1270090 35402061 ~ 35405887 (+) True XLOC_010091
TCONS_00020056 other downstream 1594047 35726018 ~ 35726132 (+) True XLOC_010096
TCONS_00020068 other downstream 2450515 36582486 ~ 36584785 (+) False XLOC_010109

Expression Profile


//