RNA id: TCONS_00020200



Basic Information


Item Value
RNA id TCONS_00020200
length 82
RNA type miRNA
GC content 0.59
exon number 1
gene id XLOC_010198
representative False

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 42897582 ~ 42901740 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TCCTACGGGCAGGGAGGTGTGGGATGTTGTGCAGTGTTGTTCAATCTCCCGCCAATATTGCACTCGTCCCGGCCTCCCTGAC

Function


GO:

id name namespace
GO:0048731 system development biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0001732 formation of cytoplasmic translation initiation complex biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0043009 chordate embryonic development biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0048513 animal organ development biological_process
GO:0043604 amide biosynthetic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0006412 translation biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0007389 pattern specification process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0007399 nervous system development biological_process
GO:0032501 multicellular organismal process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0032502 developmental process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:0060322 head development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0044391 ribosomal subunit cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0022625 cytosolic large ribosomal subunit cellular_component
GO:0022626 cytosolic ribosome cellular_component
GO:0044445 obsolete cytosolic part cellular_component
GO:0005829 cytosol cellular_component
GO:0005840 ribosome cellular_component
GO:0005852 eukaryotic translation initiation factor 3 complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0033290 eukaryotic 48S preinitiation complex cellular_component
GO:0016282 eukaryotic 43S preinitiation complex cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0001227 DNA-binding transcription repressor activity, RNA polymerase II-specific molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0003735 structural constituent of ribosome molecular_function
GO:0003755 peptidyl-prolyl cis-trans isomerase activity molecular_function
GO:0016859 cis-trans isomerase activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko00230 Purine metabolism
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko05164 Influenza A
ko05016 Huntington disease
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000122236

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00022016 lncRNA upstream 97698 42795604 ~ 42800731 (+) True XLOC_010195
TCONS_00020192 lncRNA upstream 116654 42772668 ~ 42781775 (+) False XLOC_010194
TCONS_00020195 lncRNA upstream 116982 42776393 ~ 42781447 (+) True XLOC_010194
TCONS_00020193 lncRNA upstream 123846 42772681 ~ 42774583 (+) False XLOC_010194
TCONS_00022015 lncRNA upstream 204766 42691059 ~ 42693663 (+) True XLOC_010193
TCONS_00022019 lncRNA downstream 142995 43041505 ~ 43048279 (+) False XLOC_010199
TCONS_00022018 lncRNA downstream 142995 43041505 ~ 43048279 (+) False XLOC_010199
TCONS_00022020 lncRNA downstream 143638 43042148 ~ 43048279 (+) False XLOC_010199
TCONS_00022021 lncRNA downstream 144209 43042719 ~ 43048279 (+) False XLOC_010199
TCONS_00022022 lncRNA downstream 145777 43044287 ~ 43048279 (+) False XLOC_010199
TCONS_00020196 mRNA upstream 55032 42829735 ~ 42843397 (+) False XLOC_010196
TCONS_00020197 mRNA upstream 55459 42830152 ~ 42842970 (+) True XLOC_010196
TCONS_00020191 mRNA upstream 214928 42667560 ~ 42683501 (+) True XLOC_010192
TCONS_00020190 mRNA upstream 403046 42482270 ~ 42495383 (+) True XLOC_010190
TCONS_00020189 mRNA upstream 404084 42481447 ~ 42494345 (+) False XLOC_010190
TCONS_00020202 mRNA downstream 179399 43077909 ~ 43118095 (+) True XLOC_010200
TCONS_00020203 mRNA downstream 240994 43139504 ~ 43150489 (+) True XLOC_010202
TCONS_00020204 mRNA downstream 254217 43152727 ~ 43284939 (+) False XLOC_010203
TCONS_00020205 mRNA downstream 254229 43152739 ~ 43159418 (+) False XLOC_010203
TCONS_00020206 mRNA downstream 320853 43219363 ~ 43243567 (+) True XLOC_010203
TCONS_00020198 other upstream 20418 42876446 ~ 42878011 (+) True XLOC_010197
TCONS_00020194 other upstream 117035 42772712 ~ 42781394 (+) False XLOC_010194
TCONS_00020166 other upstream 1349992 41546763 ~ 41548437 (+) True XLOC_010175
TCONS_00020157 other upstream 1844197 41042310 ~ 41054232 (+) False XLOC_010166
TCONS_00020150 other upstream 2312653 40576679 ~ 40585776 (+) False XLOC_010161
TCONS_00020214 other downstream 1706816 44605326 ~ 44605440 (+) True XLOC_010211
TCONS_00020216 other downstream 1784555 44683065 ~ 44687935 (+) True XLOC_010212
TCONS_00020217 other downstream 1805862 44704372 ~ 44705154 (+) True XLOC_010213
TCONS_00020228 other downstream 2689704 45588214 ~ 45588330 (+) True XLOC_010221
TCONS_00020229 other downstream 2768225 45666735 ~ 45666852 (+) True XLOC_010222