RNA id: TCONS_00023939


Basic Information

Item Value
RNA id TCONS_00023939
length 450
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_012146
representative False

Chromosome Information

Item Value
chromosome id NC_007128.7
NCBI id CM002901.2
chromosome length 53461100
location 26713111 ~ 26721007 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCTGACCAACTCACCGAGGAGCAAATTGCAGAGTTTAAGGAGGCTTTCTCCTTATTTGATAAGGATGGTGATGGTACTATCACCACCAAGGAGCTGGGCACAGTGATGCGCTCGCTCGGACAGAACCCCACAGAAGCTGAACTCCAGGACATGATAAACGAGGTGGACGCTGATGGTAACGGAACCATTGACTTTCCTGAATTTCTGACAATGATGGCCCGGAAAATGAAAGACACAGACAGCGAGGAGGAGATCCGCGAAGCTTTCCGAGTGTTTGACAAGGACGGGAACGGCTACATCAGTGCGGCAGAGCTTCGCCATGTCATGACAAACCTGGGTGAGAAACTAACAGATGAAGAGGTGGATGAAATGATCAGAGAAGCTGACATCGACGGTGACGGTCAGGTCAATTACGAAGAATTTGTACAAATGATGACGGCAAAGTGA

Function

GO:

id name namespace
GO:0021555 midbrain-hindbrain boundary morphogenesis biological_process

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-8308 Acts upstream of or within midbrain-hindbrain boundary morphogenesis. Is expressed in several structures, including mesoderm; midbrain neural keel; nervous system; neural tube; and trigeminal placode. Human ortholog(s) of this gene implicated in catecholaminergic polymorphic ventricular tachycardia 4 and long QT syndrome 14. Orthologous to human CALM1 (calmodulin 1).

Ensembl:

ensembl_id ENSDART00000186813

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00023937 lncRNA downstream 103349 26609651 ~ 26610787 (-) True XLOC_012145
TCONS_00024909 lncRNA downstream 758946 25953510 ~ 25955190 (-) True XLOC_012142
TCONS_00023929 lncRNA downstream 816352 25893422 ~ 25897784 (-) True XLOC_012141
TCONS_00023924 lncRNA downstream 1043608 25669839 ~ 25670528 (-) True XLOC_012136
TCONS_00023923 lncRNA downstream 1063269 25650011 ~ 25650867 (-) False XLOC_012136
TCONS_00023941 lncRNA upstream 64105 26783926 ~ 26801744 (-) False XLOC_012147
TCONS_00024910 lncRNA upstream 81150 26800971 ~ 26802736 (-) True XLOC_012147
TCONS_00024911 lncRNA upstream 230591 26950412 ~ 26968341 (-) True XLOC_012151
TCONS_00023948 lncRNA upstream 262214 26982035 ~ 26985759 (-) True XLOC_012152
TCONS_00024912 lncRNA upstream 682822 27402643 ~ 27403751 (-) True XLOC_012158
TCONS_00023935 mRNA downstream 103274 26608510 ~ 26610862 (-) False XLOC_012145
TCONS_00023936 mRNA downstream 103322 26608512 ~ 26610814 (-) False XLOC_012145
TCONS_00023933 mRNA downstream 109190 26589879 ~ 26604946 (-) False XLOC_012144
TCONS_00023934 mRNA downstream 109587 26590667 ~ 26604549 (-) True XLOC_012144
TCONS_00023931 mRNA downstream 176208 26480507 ~ 26537928 (-) False XLOC_012143
TCONS_00023942 mRNA upstream 130303 26850124 ~ 26867725 (-) False XLOC_012148
TCONS_00023943 mRNA upstream 130337 26850158 ~ 26868169 (-) False XLOC_012148
TCONS_00023945 mRNA upstream 159904 26879725 ~ 26926577 (-) False XLOC_012149
TCONS_00023946 mRNA upstream 161393 26881214 ~ 26911852 (-) True XLOC_012149
TCONS_00023947 mRNA upstream 208597 26928418 ~ 26935339 (-) True XLOC_012150
TCONS_00023928 other downstream 849717 25864305 ~ 25864419 (-) True XLOC_012140
TCONS_00023915 other downstream 1125706 25587625 ~ 25588430 (-) True XLOC_012133
TCONS_00023914 other downstream 1127278 25585487 ~ 25586858 (-) True XLOC_012132
TCONS_00023912 other downstream 1191385 25512924 ~ 25522751 (-) True XLOC_012130
TCONS_00023897 other downstream 1776452 24932691 ~ 24937684 (-) False XLOC_012122
TCONS_00023944 other upstream 147870 26867691 ~ 26874040 (-) True XLOC_012148
TCONS_00023954 other upstream 483300 27203121 ~ 27205806 (-) False XLOC_012154
TCONS_00023956 other upstream 495070 27214891 ~ 27235466 (-) True XLOC_012154
TCONS_00023977 other upstream 1810646 28530467 ~ 28530582 (-) True XLOC_012163
TCONS_00023979 other upstream 1904227 28624048 ~ 28624176 (-) True XLOC_012165

Expression Profile

//