RNA id: TCONS_00031734


Basic Information

Item Value
RNA id TCONS_00031734
length 384
lncRNA type retained_intron
GC content 0.52
exon number 5
gene id XLOC_016060
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 881954 ~ 898899 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAGATGGACACGGCTGAATTCCCGTCACTGCTGTAACTTTAAGGGGGAATGATCTGCGATGAGGGAAATGAGATGAGAATCAGATCGCTCAACCCTTCAGGTTCTGCCTGACCTGTACTTGGGTAATTTCAAAGATGCCAGAGATCGTGAGCAGTTGGCCAGAAACAACATCACACACATCCTCTCCATCCACGATACTGCAGCGCCCATATTACAGGTGCACATCCAGCACTTTAGGCAGAGCATTGCGTTCATTCACCAATCTCGACTGAAAGGGGAAGGCTGTCTAGTTCACTGTTTGGCAGGAGTTTCCCGTAGCGTGACGCTGGTGGTGGCCTACATCATGACCGTCACCACGCTGGGCTGGCAGGAGGCTCTGGCTGC

Function

GO:

id name namespace
GO:0007179 transforming growth factor beta receptor signaling pathway biological_process
GO:0042127 regulation of cell population proliferation biological_process
GO:0046330 positive regulation of JNK cascade biological_process
GO:0006470 protein dephosphorylation biological_process
GO:0016311 dephosphorylation biological_process
GO:0005829 cytosol cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008138 protein tyrosine/serine/threonine phosphatase activity molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0016791 phosphatase activity molecular_function
GO:0004721 phosphoprotein phosphatase activity molecular_function
GO:0004725 protein tyrosine phosphatase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050417-257 Predicted to enable protein tyrosine phosphatase activity and protein tyrosine/serine/threonine phosphatase activity. Predicted to be involved in positive regulation of JNK cascade; regulation of cell population proliferation; and transforming growth factor beta receptor signaling pathway. Predicted to act upstream of or within protein dephosphorylation. Predicted to be located in cytoplasm and nucleus. Predicted to be active in cytosol. Orthologous to human DUSP22 (dual specificity phosphatase 22).

Ensembl:

ensembl_id ENSDART00000137637

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033756 lncRNA downstream 153876 728660 ~ 730230 (-) True XLOC_016057
TCONS_00033343 lncRNA downstream 269250 552481 ~ 614856 (-) False XLOC_016051
TCONS_00033342 lncRNA downstream 269250 552481 ~ 614856 (-) False XLOC_016051
TCONS_00033755 lncRNA downstream 269302 565097 ~ 614804 (-) True XLOC_016051
TCONS_00033341 lncRNA downstream 351662 495311 ~ 532444 (-) True XLOC_016050
TCONS_00033757 lncRNA upstream 32277 931068 ~ 1195912 (-) True XLOC_016061
TCONS_00033758 lncRNA upstream 219961 1118752 ~ 1121302 (-) True XLOC_016063
TCONS_00033344 lncRNA upstream 416375 1315166 ~ 1331542 (-) True XLOC_016067
TCONS_00033345 lncRNA upstream 506720 1405511 ~ 1406153 (-) True XLOC_016069
TCONS_00033346 lncRNA upstream 601116 1499907 ~ 1514014 (-) True XLOC_016073
TCONS_00031731 mRNA downstream 4306 854444 ~ 879800 (-) True XLOC_016059
TCONS_00031730 mRNA downstream 151242 731491 ~ 732864 (-) True XLOC_016058
TCONS_00031729 mRNA downstream 161936 720781 ~ 722170 (-) True XLOC_016056
TCONS_00031728 mRNA downstream 167680 713080 ~ 716426 (-) True XLOC_016055
TCONS_00031727 mRNA downstream 176954 696244 ~ 707152 (-) True XLOC_016054
TCONS_00031735 mRNA upstream 45550 944341 ~ 985417 (-) False XLOC_016062
TCONS_00031737 mRNA upstream 275987 1174778 ~ 1188707 (-) True XLOC_016064
TCONS_00031738 mRNA upstream 319967 1218758 ~ 1227221 (-) True XLOC_016065
TCONS_00031739 mRNA upstream 366180 1264971 ~ 1279387 (-) True XLOC_016066
TCONS_00031741 mRNA upstream 449490 1348281 ~ 1364678 (-) False XLOC_016068
TCONS_00031725 other downstream 300539 583451 ~ 583567 (-) True XLOC_016052
TCONS_00031736 other upstream 51457 950248 ~ 956225 (-) True XLOC_016062
TCONS_00031757 other upstream 1402567 2301358 ~ 2301434 (-) True XLOC_016081
TCONS_00031768 other upstream 2227167 3125958 ~ 3126074 (-) True XLOC_016090
TCONS_00031770 other upstream 2488781 3387572 ~ 3403034 (-) False XLOC_016091
TCONS_00031782 other upstream 3215327 4114118 ~ 4114216 (-) False XLOC_016100

Expression Profile

//