RNA id: TCONS_00031785


Basic Information

Item Value
RNA id TCONS_00031785
length 831
RNA type mRNA
GC content 0.53
exon number 2
gene id XLOC_016101
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 4490604 ~ 4496358 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGCATGTCACTACTAAGGACAATCATTTTGGGCATCATCCTGACTGGACATCTGTGTGGAGGTCAAGACGAACTACTAGAGGACAGTTTAGAGACAGCAGTGGATGAAGTGGCCACTGAGGGAATCGAGGAGCTGGAGGAACCTGAGGAAGAGGGGTTGGATCTCAGTCCACCTGATGACAGACAGCCATGTGCCATGTGGATGGGCGGTGTTCCAGGCACACCTGGGCACAGTGGAAAACCTGGAAGAGATGGCAGAGATGGACGTGACGGACAGAGGGGCGAGAAAGGAGATCAAGGTGAAGCAGGTGAGAAAGGCGACCCTGGAGAAAAGGGAGACATAGGCAACGCAGGACCAAGAGGCTTTCCTGGCAACCCAGGCCTAAAAGGGGCTCGAGGCGAAAGTGCCTCGTCCTACCATTCAGCTTTCAGTGTAGGTCTCAGTGAGATTGTTTCCGCCACCAACGTGCCAATCCGCTTCAACAAGTTCTTCTACAACGACCAGCACCACTATGATGATGTGTCCGGAAAGTTCCGCTGCGTCCTGCCTGGAGTCTACTTCTTCACGTACCATCTGACCGTCTACACTAAAGATGCGAAGGTCAGTCTCTACAAGAACGACAAGGCCATCATGTTCACTTATGACCAGTACCAGGAGACCAATGTGGACCAGGCGTCAGGCTCTGTGATCTTGCGTTTGGAGGCAGGAGATGAAGTGTGGCTGCAGGTCTATGGAGACGAGACGGTTGGAGGAGTGTATGCTGATAATACCAATGACTCCACCTTCTCCGGTTTTCTCCTGTATCCTGTTAGTCCCGCAGAGAGACGCTGA

Function

GO:

id name namespace
GO:0005576 extracellular region cellular_component
GO:0005581 collagen trimer cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-060825-220 Predicted to enable hormone activity. Predicted to be located in extracellular region. Predicted to be part of collagen trimer. Is expressed in several structures, including adipose tissue; ball; liver; notochord; and pancreas. Human ortholog(s) of this gene implicated in several diseases, including carcinoma (multiple); cardiovascular system disease (multiple); non-alcoholic fatty liver disease; primary open angle glaucoma; and type 2 diabetes mellitus. Orthologous to human ADIPOQ (adiponectin, C1Q and collagen domain containing).

Ensembl:

ensembl_id ENSDART00000191702

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033348 lncRNA downstream 372009 4114011 ~ 4118815 (-) False XLOC_016100
TCONS_00033762 lncRNA downstream 970658 3519583 ~ 3520166 (-) True XLOC_016095
TCONS_00031772 lncRNA downstream 1074617 3412076 ~ 3416207 (-) True XLOC_016092
TCONS_00033761 lncRNA downstream 1087790 3394950 ~ 3403034 (-) False XLOC_016091
TCONS_00033760 lncRNA downstream 1087804 3394950 ~ 3403020 (-) False XLOC_016091
TCONS_00031790 lncRNA upstream 284861 4779100 ~ 4797512 (-) True XLOC_016104
TCONS_00031791 lncRNA upstream 318455 4812694 ~ 4814272 (-) True XLOC_016105
TCONS_00033763 lncRNA upstream 955542 5449781 ~ 5453522 (-) True XLOC_016113
TCONS_00031813 lncRNA upstream 969169 5463408 ~ 5466487 (-) False XLOC_016114
TCONS_00031815 lncRNA upstream 980304 5474543 ~ 5475702 (-) False XLOC_016114
TCONS_00031781 mRNA downstream 419974 4044636 ~ 4070850 (-) True XLOC_016099
TCONS_00031780 mRNA downstream 458092 4019538 ~ 4032732 (-) True XLOC_016098
TCONS_00031778 mRNA downstream 812795 3630307 ~ 3678029 (-) False XLOC_016097
TCONS_00031779 mRNA downstream 835841 3631281 ~ 3654983 (-) True XLOC_016097
TCONS_00031777 mRNA downstream 876819 3603758 ~ 3614005 (-) True XLOC_016096
TCONS_00031787 mRNA upstream 137096 4631335 ~ 4642407 (-) True XLOC_016103
TCONS_00031788 mRNA upstream 234916 4729155 ~ 4787566 (-) False XLOC_016104
TCONS_00031789 mRNA upstream 281609 4775848 ~ 4787576 (-) False XLOC_016104
TCONS_00031792 mRNA upstream 355030 4849269 ~ 4874966 (-) False XLOC_016106
TCONS_00031793 mRNA upstream 355474 4849713 ~ 4868002 (-) True XLOC_016106
TCONS_00031783 other downstream 374424 4116314 ~ 4116400 (-) True XLOC_016100
TCONS_00031782 other downstream 376608 4114118 ~ 4114216 (-) False XLOC_016100
TCONS_00031770 other downstream 1087790 3387572 ~ 3403034 (-) False XLOC_016091
TCONS_00031768 other downstream 1364750 3125958 ~ 3126074 (-) True XLOC_016090
TCONS_00031757 other downstream 2189390 2301358 ~ 2301434 (-) True XLOC_016081
TCONS_00031786 other upstream 76774 4571013 ~ 4571103 (-) True XLOC_016102
TCONS_00031796 other upstream 409321 4903560 ~ 5014629 (-) False XLOC_016107
TCONS_00031798 other upstream 413557 4907796 ~ 4925127 (-) False XLOC_016107
TCONS_00031799 other upstream 448721 4942960 ~ 4984404 (-) False XLOC_016107
TCONS_00031800 other upstream 545928 5040167 ~ 5043850 (-) False XLOC_016107

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000003_01126525_01129929.mRNA True 1696 mRNA 0.43 2 CI01000003 1126098 ~ 1130325 (+)