RNA id: TCONS_00031895


Basic Information

Item Value
RNA id TCONS_00031895
length 485
RNA type processed_transcript
GC content 0.53
exon number 3
gene id XLOC_016164
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 8663108 ~ 8688759 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTCCTTATCTGCATTTCTCACGCTGATCTCGGTGTGCCGTCAGCTGAGCAGTTGATCCGAAGTTTAACGTTGCCTTATGTCTCTCCAATCCCTCTCTGGGCAGGTGAGTCTGAGCACCGGCACCAAGAAGCTTTTTGCCGCTACCGCCTTCGGTGCCGTCTCCCTCATCATCATCGCACGACGCTTCAGGAGGAGAAAAGGCAGGAGGAAAGCCAATTCTCCAGTAGAACAGGAAACATTTGAGTTCCTCACCACCATCCACCTGAGTAAAGAGAGTGACAGTCAAAGTGTGCCTCAGAACTCAGAGAACCCCTACACGTGTAATGTGGTGTCCGGGGCCCTGTACAACAAGCTTTCAGGCTCACTGCCAAGTCTGGTTTCTGTGAGGAGCAGGCACTCCTCTAGCAGCTCTACGTGTGCTAATGGTTCCAATTGTTGGGAAGAAGCAGGAGACGCCGCTGACGTCTGTAACCTGCTCAGCCTCC

Function

GO:

id name namespace
GO:0008053 mitochondrial fusion biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0005741 mitochondrial outer membrane cellular_component
GO:0042803 protein homodimerization activity molecular_function
GO:0046982 protein heterodimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041010-193 Predicted to enable protein heterodimerization activity and protein homodimerization activity. Predicted to be involved in mitochondrial fusion. Predicted to be integral component of plasma membrane. Orthologous to human MIGA1 (mitoguardin 1).

Ensembl:

ensembl_id ENSDART00000143884

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033772 lncRNA downstream 186226 8491044 ~ 8494716 (-) False XLOC_016159
TCONS_00033773 lncRNA downstream 186226 8491044 ~ 8494716 (-) False XLOC_016159
TCONS_00031885 lncRNA downstream 186226 8491044 ~ 8494716 (-) False XLOC_016159
TCONS_00031884 lncRNA downstream 186231 8491044 ~ 8494711 (-) False XLOC_016159
TCONS_00031883 lncRNA downstream 186803 8491405 ~ 8494139 (-) True XLOC_016159
TCONS_00033774 lncRNA upstream 150989 8835922 ~ 8840884 (-) True XLOC_016165
TCONS_00033775 lncRNA upstream 645313 9330246 ~ 9419088 (-) True XLOC_016168
TCONS_00033351 lncRNA upstream 1061504 9746437 ~ 9747547 (-) False XLOC_016178
TCONS_00031912 lncRNA upstream 1061504 9746437 ~ 9748047 (-) False XLOC_016178
TCONS_00033350 lncRNA upstream 1061504 9746437 ~ 9748084 (-) False XLOC_016178
TCONS_00031893 mRNA downstream 32502 8644422 ~ 8648440 (-) True XLOC_016163
TCONS_00031890 mRNA downstream 44767 8617816 ~ 8636175 (-) False XLOC_016161
TCONS_00031891 mRNA downstream 49137 8617819 ~ 8631805 (-) True XLOC_016161
TCONS_00031889 mRNA downstream 69267 8586953 ~ 8611675 (-) True XLOC_016160
TCONS_00031888 mRNA downstream 71289 8586415 ~ 8609653 (-) False XLOC_016160
TCONS_00031896 mRNA upstream 160907 8845840 ~ 9059955 (-) True XLOC_016166
TCONS_00031897 mRNA upstream 476014 9160947 ~ 9259283 (-) False XLOC_016167
TCONS_00031898 mRNA upstream 476014 9160947 ~ 9260002 (-) True XLOC_016167
TCONS_00031899 mRNA upstream 645213 9330146 ~ 9489611 (-) False XLOC_016168
TCONS_00031901 mRNA upstream 828227 9513160 ~ 9527210 (-) False XLOC_016170
TCONS_00031892 other downstream 45810 8634240 ~ 8635132 (-) True XLOC_016162
TCONS_00031853 other downstream 1772261 6908662 ~ 6908681 (-) True XLOC_016140
TCONS_00031851 other downstream 1914535 6766293 ~ 6766407 (-) True XLOC_016138
TCONS_00031833 other downstream 2635547 6042039 ~ 6045395 (-) False XLOC_016126
TCONS_00031821 other downstream 3119923 5554665 ~ 5561019 (-) False XLOC_016117
TCONS_00031900 other upstream 721625 9406558 ~ 9406675 (-) True XLOC_016169
TCONS_00031903 other upstream 844555 9529488 ~ 9544161 (-) False XLOC_016171
TCONS_00031909 other upstream 1003122 9688055 ~ 9688185 (-) True XLOC_016176
TCONS_00031914 other upstream 1061925 9746858 ~ 9746993 (-) False XLOC_016178
TCONS_00031915 other upstream 1062369 9747302 ~ 9747431 (-) True XLOC_016178

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
bowfin (Amia calva) TU12568 True 277 lncRNA 0.51 3 CM030121.1 56606421 ~ 56647806 (-)
tiger barb (Puntius tetrazona) TU12568 False 461 lncRNA 0.52 2 NC_056700.1 998819 ~ 999689 (-)