RNA id: TCONS_00031906


Basic Information

Item Value
RNA id TCONS_00031906
length 564
RNA type mRNA
GC content 0.47
exon number 7
gene id XLOC_016173
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 9621289 ~ 9625548 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTGTGAAATTGGTATTATGTGCTGTTTGCTGTGGCGCTGTGGTATCGCCGGTCCGGTCGGAGGGTTTAAATCTCCAGTTTTGGGTCTCACTGGAAAGGCGTGCAACCCGCTCGCGCGCTCTCTCCTCTGGAACGTGTCGGCTGTACTAGAGATGGACCATTTGTTCAGCGGGTTTGACTGCGCGCAGCAAAACGCAGAAGTTTACCTCAAGACGCAAACGGTGTCTGTCTGCACACCACAGAACTCCAACTGTGCTCAAAGTGCTATCGTAAATATAGATGAGAGCGAATGCCTACAGAGAATTCTGGAAGATCTCCACTACTATCGGGAAACATTTCTAGCCTACTCTAAACCTGAGCTCACCACAACTGTAGTCAGAGGCATTGAGGATGTCATGCAGAACTGTTTCTCTGTCTCTGTAACGGAGAATTCTCCAGCCAAGGCATCCATGGATCATCAAAAATCTTTTCAAGAACGACTGAAGCTGTGTAAAATCCTAAAGGGGTTCAGCCTTCGAGCAATAACAATCAATCGAGTTTTCAACTACATCTTGACAAAATAG

Function

GO:

id name namespace
GO:0006955 immune response biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005125 cytokine activity molecular_function
GO:0005143 interleukin-12 receptor binding molecular_function
GO:0008083 growth factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-140106-87 Predicted to enable cytokine activity; growth factor activity; and interleukin-12 receptor binding activity. Predicted to act upstream of or within immune response. Predicted to be located in extracellular space.

Ensembl:

ensembl_id ENSDART00000097683

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033775 lncRNA downstream 202201 9330246 ~ 9419088 (-) True XLOC_016168
TCONS_00033774 lncRNA downstream 780405 8835922 ~ 8840884 (-) True XLOC_016165
TCONS_00031883 lncRNA downstream 1127150 8491405 ~ 8494139 (-) True XLOC_016159
TCONS_00031881 lncRNA downstream 1127277 8491082 ~ 8494012 (-) False XLOC_016159
TCONS_00033351 lncRNA upstream 120889 9746437 ~ 9747547 (-) False XLOC_016178
TCONS_00031912 lncRNA upstream 120889 9746437 ~ 9748047 (-) False XLOC_016178
TCONS_00033350 lncRNA upstream 120889 9746437 ~ 9748084 (-) False XLOC_016178
TCONS_00033776 lncRNA upstream 120889 9746437 ~ 9748161 (-) False XLOC_016178
TCONS_00033778 lncRNA upstream 120889 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00031905 mRNA downstream 13410 9592319 ~ 9607879 (-) True XLOC_016172
TCONS_00031904 mRNA downstream 77128 9529523 ~ 9544161 (-) True XLOC_016171
TCONS_00031901 mRNA downstream 94079 9513160 ~ 9527210 (-) False XLOC_016170
TCONS_00031902 mRNA downstream 94160 9518302 ~ 9527129 (-) True XLOC_016170
TCONS_00031899 mRNA downstream 131678 9330146 ~ 9489611 (-) False XLOC_016168
TCONS_00031907 mRNA upstream 4010 9629558 ~ 9646857 (-) True XLOC_016174
TCONS_00031908 mRNA upstream 58757 9684305 ~ 9696283 (-) True XLOC_016175
TCONS_00031910 mRNA upstream 76505 9702053 ~ 9744081 (-) True XLOC_016177
TCONS_00031913 mRNA upstream 120946 9746494 ~ 9748039 (-) False XLOC_016178
TCONS_00031916 mRNA upstream 164263 9789811 ~ 9818711 (-) False XLOC_016179
TCONS_00031903 other downstream 77128 9529488 ~ 9544161 (-) False XLOC_016171
TCONS_00031900 other downstream 214614 9406558 ~ 9406675 (-) True XLOC_016169
TCONS_00031895 other downstream 936356 8680942 ~ 8684933 (-) True XLOC_016164
TCONS_00031892 other downstream 986157 8634240 ~ 8635132 (-) True XLOC_016162
TCONS_00031853 other downstream 2712608 6908662 ~ 6908681 (-) True XLOC_016140
TCONS_00031909 other upstream 62507 9688055 ~ 9688185 (-) True XLOC_016176
TCONS_00031914 other upstream 121310 9746858 ~ 9746993 (-) False XLOC_016178
TCONS_00031915 other upstream 121754 9747302 ~ 9747431 (-) True XLOC_016178
TCONS_00031958 other upstream 1279514 10905062 ~ 10905179 (-) True XLOC_016199
TCONS_00031983 other upstream 2031005 11656553 ~ 11662923 (-) True XLOC_016210

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000003_01907347_01909263.mRNA True 1102 mRNA 0.40 6 CI01000003 1907122 ~ 1909600 (+)