RNA id: TCONS_00031920



Basic Information


Item Value
RNA id TCONS_00031920
length 662
RNA type mRNA
GC content 0.52
exon number 5
gene id XLOC_016179
representative False

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 9789811 ~ 9818711 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TGCTGATCTCCCGTGTCTACCGCGATGATATAGGGCGAAACGCAGTGGATGCGTTCCGTGTGAACGTGATCCATGCCCGTCAGCAGGTGCGCTCTCCGGTCACCAACATTGCCCGCACCAGCTTCTTCCACGTCAAGCGCTCCAACATCTGGCTGGCTGCCGTCACCAAGCAGAATGTCAACGCTGCTATGGTGTTCGAGTTCCTCTACAAGATGTGCGACGTCATGACGGCCTACTTTGGGAAGATCAGCGAGGAAAATATCAAGAATAACTTTGTACTTATCTACGAGTTGCTGGATGAGATTCTGGACTTTGGATACCCGCAGAACTCGGAGACAGGAGCGCTGAAGACCTTTATTACCCAGCAGGGCATTAAAGGCCAGACTAAGGAGGAACAGTCTCAGATCACCAGCCAGGTGACGGGTCAAATCGGTTGGCGTCGTGAAGGCATCAAGTACCGCCGCAATGAGCTCTTCCTGGATGTGCTGGAGAGTGTCAACTTGCTTATGTCTCCCCAGGGTCAGGTCCTGAGTGCTCACGTCTCTGGTCGTGTGGTGATGAAAAGCTATCTGAGCGGAATGCCTGAATGCAAATTTGGAATGAATGACAAAATCGTCATCGACAAGCAGGGCAAAGGAGGAACCACTGATGATGCTGGGAAA

Function


GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0006897 endocytosis biological_process
GO:0016192 vesicle-mediated transport biological_process
GO:0015031 protein transport biological_process
GO:0072583 clathrin-dependent endocytosis biological_process
GO:0016055 Wnt signaling pathway biological_process
GO:0030122 AP-2 adaptor complex cellular_component
GO:0030131 clathrin adaptor complex cellular_component
GO:0005886 plasma membrane cellular_component
GO:0005905 clathrin-coated pit cellular_component
GO:0031410 cytoplasmic vesicle cellular_component
GO:0016020 membrane cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0035615 clathrin adaptor activity molecular_function
GO:0008289 lipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-9784 Predicted to enable clathrin adaptor activity. Acts upstream of or within Wnt signaling pathway. Predicted to be located in clathrin-coated pit. Predicted to be part of AP-2 adaptor complex. Predicted to be active in cytoplasmic vesicle. Is expressed in blood; mesoderm; notochord; sensory system; and solid lens vesicle. Human ortholog(s) of this gene implicated in autosomal dominant non-syndromic intellectual disability. Orthologous to human AP2M1 (adaptor related protein complex 2 subunit mu 1).

Ensembl:

ensembl_id ENSDART00000138472

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00033778 lncRNA downstream 53388 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00033777 lncRNA downstream 53388 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00031911 lncRNA downstream 53388 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00033776 lncRNA downstream 53443 9746437 ~ 9748161 (-) False XLOC_016178
TCONS_00033350 lncRNA downstream 53520 9746437 ~ 9748084 (-) False XLOC_016178
TCONS_00031924 lncRNA upstream 46341 9862833 ~ 9863388 (-) True XLOC_016181
TCONS_00031942 lncRNA upstream 612401 10428893 ~ 10432848 (-) True XLOC_016191
TCONS_00031950 lncRNA upstream 805743 10622235 ~ 10632377 (-) True XLOC_016194
TCONS_00031964 lncRNA upstream 1139729 10956221 ~ 11027191 (-) True XLOC_016200
TCONS_00031975 lncRNA upstream 1434605 11251097 ~ 11258378 (-) True XLOC_016203
TCONS_00031913 mRNA downstream 53565 9746494 ~ 9748039 (-) False XLOC_016178
TCONS_00031910 mRNA downstream 57523 9702053 ~ 9744081 (-) True XLOC_016177
TCONS_00031908 mRNA downstream 105321 9684305 ~ 9696283 (-) True XLOC_016175
TCONS_00031907 mRNA downstream 154747 9629558 ~ 9646857 (-) True XLOC_016174
TCONS_00031906 mRNA downstream 176056 9621289 ~ 9625548 (-) True XLOC_016173
TCONS_00031923 mRNA upstream 32144 9848636 ~ 9857932 (-) True XLOC_016180
TCONS_00031925 mRNA upstream 52109 9868601 ~ 9915814 (-) False XLOC_016182
TCONS_00031926 mRNA upstream 52566 9869058 ~ 9915870 (-) True XLOC_016182
TCONS_00031927 mRNA upstream 141589 9958081 ~ 9971651 (-) False XLOC_016183
TCONS_00031928 mRNA upstream 141589 9958081 ~ 9971728 (-) False XLOC_016183
TCONS_00031915 other downstream 54173 9747302 ~ 9747431 (-) True XLOC_016178
TCONS_00031914 other downstream 54611 9746858 ~ 9746993 (-) False XLOC_016178
TCONS_00031909 other downstream 113419 9688055 ~ 9688185 (-) True XLOC_016176
TCONS_00031903 other downstream 257443 9529488 ~ 9544161 (-) False XLOC_016171
TCONS_00031900 other downstream 394929 9406558 ~ 9406675 (-) True XLOC_016169
TCONS_00031958 other upstream 1088570 10905062 ~ 10905179 (-) True XLOC_016199
TCONS_00031983 other upstream 1840061 11656553 ~ 11662923 (-) True XLOC_016210
TCONS_00031991 other upstream 2407931 12224423 ~ 12224539 (-) True XLOC_016216
TCONS_00031998 other upstream 3435660 13252152 ~ 13254797 (-) True XLOC_016221
TCONS_00032033 other upstream 5177901 14994393 ~ 14994490 (-) True XLOC_016250

Expression Profile


//