RNA id: TCONS_00031942


Basic Information

Item Value
RNA id TCONS_00031942
length 543
lncRNA type retained_intron
GC content 0.52
exon number 3
gene id XLOC_016191
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 10396579 ~ 10450784 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGAATGAATGCTCTCAGGATGAAAGTGGTGCGGCGGCCATCTTCTCCACACAGCTGGATGACTTTCTTGGTGGCAGCCCTGTTCAGTTCCGCGAGGTCCAAAACAACGAGTCGCTCACCTTCCTGGGTTACTTCAAGTCCGGCATCAAGTATATGCAAGGTGGAGTTGCGTCTGGCTTCCATCACGTGTCGACCAATGATGTGAATGTGAAACGTCTGCTGCACATTAAGGGCAGGAGGGTCATCAGAGCTACAGAGGTGGCGATGTCCTGGGCCAGCTTCAACAAAGGAGACTGCTTTATCGTCGACCTGGGGAAGGATATTTATCAGTGGTGTGGCAGTGGCTGCAACCGATTTGAGCGTCTGAAAGCCTCCAAGCTGGCTATTGATATCCGGGACAACGAGAGGAACGGCAGAGCCAAGCTGGTCATGGTGGAGGAGGACGCTGAACCAGACGCCCTGATTCAAGTCAGTCAAGTTTAAGCTCTACTTCTCCTTTAACAATTTCCACACAACCACCAGGATGAATGATTCCGTGGCTGAT

Function

GO:

id name namespace
GO:0008154 actin polymerization or depolymerization biological_process
GO:0051014 actin filament severing biological_process
GO:0051016 barbed-end actin filament capping biological_process
GO:0030031 cell projection assembly biological_process
GO:0007417 central nervous system development biological_process
GO:0015629 actin cytoskeleton cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005546 phosphatidylinositol-4,5-bisphosphate binding molecular_function
GO:0051015 actin filament binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2068 Predicted to enable actin filament binding activity and phosphatidylinositol-4,5-bisphosphate binding activity. Predicted to be involved in several processes, including actin filament severing; actin polymerization or depolymerization; and barbed-end actin filament capping. Predicted to act upstream of or within actin nucleation and cell projection organization. Predicted to be active in actin cytoskeleton and cytoplasm. Is expressed in several structures, including central nervous system; cornea; digestive system; hatching gland; and swim bladder. Orthologous to human SCIN (scinderin).

Ensembl:

ensembl_id ENSDART00000148031

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00031924 lncRNA downstream 565505 9862833 ~ 9863388 (-) True XLOC_016181
TCONS_00031921 lncRNA downstream 624346 9804247 ~ 9804547 (-) False XLOC_016179
TCONS_00033778 lncRNA downstream 680677 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00033777 lncRNA downstream 680677 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00031911 lncRNA downstream 680677 9746437 ~ 9748216 (-) False XLOC_016178
TCONS_00031950 lncRNA upstream 189387 10622235 ~ 10632377 (-) True XLOC_016194
TCONS_00031964 lncRNA upstream 523373 10956221 ~ 11027191 (-) True XLOC_016200
TCONS_00031975 lncRNA upstream 818249 11251097 ~ 11258378 (-) True XLOC_016203
TCONS_00031976 lncRNA upstream 897876 11330724 ~ 11331316 (-) True XLOC_016204
TCONS_00031977 lncRNA upstream 904192 11337040 ~ 11337983 (-) True XLOC_016205
TCONS_00031940 mRNA downstream 42155 10342177 ~ 10386738 (-) True XLOC_016190
TCONS_00031938 mRNA downstream 90080 10287133 ~ 10338813 (-) False XLOC_016189
TCONS_00031939 mRNA downstream 90134 10291037 ~ 10338759 (-) True XLOC_016189
TCONS_00031936 mRNA downstream 236406 10185330 ~ 10192487 (-) False XLOC_016188
TCONS_00031937 mRNA downstream 236434 10185355 ~ 10192459 (-) True XLOC_016188
TCONS_00031944 mRNA upstream 34951 10467799 ~ 10563576 (-) False XLOC_016192
TCONS_00031943 mRNA upstream 34951 10467799 ~ 10563576 (-) False XLOC_016192
TCONS_00031945 mRNA upstream 35514 10468362 ~ 10564019 (-) True XLOC_016192
TCONS_00031946 mRNA upstream 164962 10597810 ~ 10600950 (-) True XLOC_016193
TCONS_00031947 mRNA upstream 170702 10603550 ~ 10641998 (-) False XLOC_016194
TCONS_00031915 other downstream 681462 9747302 ~ 9747431 (-) True XLOC_016178
TCONS_00031914 other downstream 681900 9746858 ~ 9746993 (-) False XLOC_016178
TCONS_00031909 other downstream 740708 9688055 ~ 9688185 (-) True XLOC_016176
TCONS_00031903 other downstream 884732 9529488 ~ 9544161 (-) False XLOC_016171
TCONS_00031900 other downstream 1022218 9406558 ~ 9406675 (-) True XLOC_016169
TCONS_00031958 other upstream 472214 10905062 ~ 10905179 (-) True XLOC_016199
TCONS_00031983 other upstream 1223705 11656553 ~ 11662923 (-) True XLOC_016210
TCONS_00031991 other upstream 1791575 12224423 ~ 12224539 (-) True XLOC_016216
TCONS_00031998 other upstream 2819304 13252152 ~ 13254797 (-) True XLOC_016221
TCONS_00032033 other upstream 4561545 14994393 ~ 14994490 (-) True XLOC_016250

Expression Profile

//